Changes

From Genome Analysis Wiki
Jump to navigationJump to search

Variant classification (view source)

Revision as of 21:44, 25 February 2016

6,474 bytes added ,  21:44, 25 February 2016
→‎Representation of close by variants
Line 3: Line 3:  
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations.  However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.  
 
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations.  However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.  
   −
On this wiki page, we describe a a variant classification system for VCF variants.
+
On this wiki page, we describe a a variant classification system for VCF entries that is invariant to [http://genome.sph.umich.edu/wiki/Variant_Normalization normalization] except for the case of MNPs.
    
= Definitions =
 
= Definitions =
   −
The definition of a variant is based on the definition of each allele with respect to the reference sequence.  We consider 5 major types as follows.
+
The definition of a variant is based on the definition of each allele with respect to the reference sequence.  We consider 5 major types loosely decribed as follows.
    
;1. SNP
 
;1. SNP
 
: The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
 
: The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
 
;2. MNP
 
;2. MNP
−
: a.The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
+
: The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
 
: OR
 
: OR
−
: b. all reference and alternate sequences have the same length.
+
: All reference and alternate sequences have the same length (this is applicable to all alleles).
 
;3. INDEL
 
;3. INDEL
−
: a. The reference and alternate sequence are not the same length.
+
: The reference and alternate sequences are not of the same length.
−
: AND
  −
: b. The removal of a subsequence of the longer sequence would reduce the longer sequence to the smaller sequence.
   
;4. CLUMPED
 
;4. CLUMPED
−
:   
+
:  A clumping of nearby SNPs, MNPs or Indels.
 
;5. SV
 
;5. SV
−
: The alternate sequence is represented by a angled bracket tag.
+
: The alternate sequence is represented by an angled bracket tag.
   −
= Simple Biallelic Examples =
+
= Classification Procedure =
 +
 
 +
#Trim each allele with respect to the reference sequence individually
 +
#Inspect length, defined as length of alternate allele minus length of reference allele.
 +
##if length = 0
 +
###if length(ref) = 1 and nucleotides differ, classify as SNP  (count ts and tv too)
 +
###if length(ref) > 1
 +
####if all nucleotides differ, classify as MNP  (count ts and tv too)
 +
####if not all nucleotides differ, classify as CLUMPED  (count ts and tv too)
 +
##if length <math>\ne</math> 0, classify as INDEL
 +
###if shorter allele is of length 1
 +
####if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification
 +
###if shorter allele length > 1
 +
####compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)
 +
#####if all nucleotides differ, add MNP classification
 +
#####if not all nucleotides differ, add CLUMPED classification
 +
#Variant classification is the union of the classifications of each allele present in the variant.
 +
#If all alleles are the same length, add MNP classification.
 +
 
 +
= Examples =
 +
 
 +
We present the following examples to explain the classification described.
 +
 
 +
== Legend for examples ==
 +
 
 +
    &lt;variant classification&gt;<br>
 +
    REF &lt;reference sequence&gt;     
 +
    ALT &lt;alternative sequence 1&gt;      #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt; 
 +
    ALT &lt;alternative sequence 2&gt;      #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt;
 +
 
 +
== Simple Biallelic Examples ==
    
     SNP<br>
 
     SNP<br>
 
     REF  A       
 
     REF  A       
−
     ALT  G    
+
     ALT  G     #SNP, 1 ts 
    
     MNP<br>
 
     MNP<br>
−
     REF  AT     
+
     REF  AT    
−
     ALT  GC
+
    ALT  GC   #MNP, 2 ts
 +
 
 +
    INDEL<br>
 +
    REF  AT     
 +
     ALT  A    #INDEL, 1 del
    
     INDEL<br>
 
     INDEL<br>
−
     REF  AT  
+
     REF  AT    
−
     ALT  A
+
     ALT  T    #INDEL, 1 del
 +
              #Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base. 
 +
              #If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles.
 +
              #Simple Indel classification should be invariant whether it is left or right aligned.
    
     SV<br>
 
     SV<br>
 
     REF  A     
 
     REF  A     
−
     ALT &lt;DEL&gt;
+
     ALT &lt;DEL&gt; #SV
   −
= Complex Biallelic Examples =
+
== Complex Biallelic Examples ==
    
     SNP|INDEL<br>
 
     SNP|INDEL<br>
−
     REF  AT  
+
     REF  AT          
−
     ALT  G
+
     ALT  G           #SNP, INDEL, 1 ts
 +
                    #Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually
 +
                    #not defined.  In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which
 +
                    #is a transversion.  In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition
 +
                    #and transversion contribution.  But please be very clear that this is an ambiguous case.  It is better to consider this simply
 +
                    #as a complex variant.
    
     MNP|INDEL<br>
 
     MNP|INDEL<br>
−
     REF  ATT  
+
     REF  ATT        
−
     ALT  GC
+
     ALT  GG          #MNP, INDEL, 1 ts, 1 tv, 1 del
    
     MNP|CLUMPED<br>
 
     MNP|CLUMPED<br>
−
     REF  ATTTT  
+
     REF  ATTTT      
−
     ALT  GTTTC
+
     ALT  GTTTC       #MNP, CLUMPED, 2 ts
 +
                    #since all the alleles are of the same length, classified as MNP too.
    
     INDEL|CLUMPED<br>
 
     INDEL|CLUMPED<br>
 
     REF  ATTTTTTTT     
 
     REF  ATTTTTTTT     
−
     ALT  GTTTC
+
     ALT  GTTTC       #INDEL, CLUMPED, 2 ts, 1 del
   −
= Simple Multiallelic Examples =
+
== Simple Multiallelic Examples ==
    
     SNP<br>
 
     SNP<br>
−
     REF  A  
+
     REF  A      
−
     ALT  G
+
     ALT  G           #SNP, 1 ts
−
     ALT  C
+
     ALT  C           #SNP, 1 tv
    
     MNP<br>
 
     MNP<br>
−
     REF  AG  
+
     REF  AG    
−
     ALT  GC
+
     ALT  GC         #MNP, 1 ts, 1 tv
−
     ALT  CT
+
     ALT  CT         #MNP, 2 tv
    
     INDEL<br>
 
     INDEL<br>
 
     REF  ATTT     
 
     REF  ATTT     
−
     ALT  ATT
+
     ALT  ATT         #INDEL, 1 del
−
     ALT  AT
+
     ALT  ATTTT      #INDEL, 1 ins
   −
= Complex Multiallelic Examples =
+
== Complex Multiallelic Examples ==
    
     SNP|MNP<br>
 
     SNP|MNP<br>
 
     REF  AT     
 
     REF  AT     
−
     ALT  GT     #SNP
+
     ALT  GT         #SNP, 1 ts
−
     ALT  AC     #SNP
+
     ALT  AC         #SNP, 1 ts
−
    #since all the alleles are of the sample length, classified as MNP too.
+
                    #since all the alleles are of the sample length, classified as MNP too.
   −
     MNP|CLUMPED<br>
+
     SNP|MNP|CLUMPED<br>
 
     REF  ATTTG     
 
     REF  ATTTG     
−
     ALT  GTTTC     #CLUMPED
+
     ALT  GTTTC       #CLUMPED, 1 ts, 1 tv
−
     ALT  ATTTC     #CLUMPED
+
     ALT  ATTTC       #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP
−
    #since all the alleles are of the sample length, classified as MNP too.
+
                    #since all the alleles are of the sample length, classified as MNP too.
    
     SNP|MNP|INDEL<br>
 
     SNP|MNP|INDEL<br>
 
     REF  GT     
 
     REF  GT     
−
     ALT  CT   #SNP
+
     ALT  CT         #SNP, 1 tv
−
     ALT  AG   #MNP
+
     ALT  AG         #MNP, 2 tv
−
     ALT  GTT   #INDEL
+
     ALT  GTT         #INDEL, 1 ins
    
     SNP|MNP|INDEL|CLUMPED<br>
 
     SNP|MNP|INDEL|CLUMPED<br>
 
     REF  GTTT     
 
     REF  GTTT     
−
     ALT  CG   #MNP|INDEL
+
     ALT  CG         #MNP, INDEL, 2 tv, 1 del
−
     ALT  AG   #MNP
+
     ALT  AG         #MNP, INDEL, 1 ts, 1 tv
−
     ALT  GTGTG #SNP|INDEL|CLUMPED
+
     ALT  GTGTG       #SNP, INDEL, CLUMPED, 1 tv, 1 ins
 +
 
 +
== Structured Variants Examples ==
 +
 
 +
    SV<br>
 +
    REF  G   
 +
    ALT &lt;INS:ME:LINE1&gt;    #SV
 +
   
 +
    SV<br>
 +
    REF  G   
 +
    ALT &lt;CN4&gt;            #SV
 +
    ALT &lt;CN12&gt;            #SV
 +
 
 +
=Interesting Variant Types =
 +
 
 +
    Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. <br>
 +
   
 +
 
 +
    20 9538655 <span style="color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> <STR>
 +
 
 +
    This can be induced as
 +
   
 +
    one record considering only the ATTT repeats
 +
    20 9538655 <span style="color:#FF0000">ATTTATTTATTT </span> <span style="color:#FF0000">ATTT </span>
 +
 
 +
    one record with CATT repeats
 +
    20 9538695 <span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>
 +
 
 +
    one record with a mix of both repeat types
 +
    20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>
   −
= SV Examples =
+
= Representation of close by variants =
   −
  ======= Structural variants ========
+
    1:124001690
−
 
+
    TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG
−
          no. of structural variants        :     41217          
+
    TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
−
              2 alleles                      :          38079
+
 
−
                  deletion                  :                13135          &lt;DEL&gt;
+
    a single complex variant
−
                  insertion                  :                16451          &lt;INS&gt;
+
     CHROM POS         REF  ALT
−
                      mobile element          :                    16253      &lt;INS:ME&gt;
+
    1    124001690  C    AAA
−
                        ALU                  :                        12513   &lt;INS:ME:ALU&gt;
+
 
−
                        LINE1                :                        2911   &lt;INS:ME:LINE1&gt;
+
    an Indel and SNP adjacent to one another
−
                        SVA                  :                          829   &lt;INS:ME:SVA&gt;
+
    CHROM POS        REF   ALT
−
                      numt                    :                      198      &lt;INS:MT&gt;
+
    1    124001689   T    TAA
−
                  duplication                :                  664          &lt;DUP&gt;
+
    1    124001690   C    A
−
                  inversion                  :                  100          &lt;INV&gt;
+
 
−
                  copy number variation      :                7729          &lt;CN4&gt;
+
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together.
−
              >=3 alleles                   :            3138
+
Representing it as 2 separate variants allows both alleles to segregate independently.
−
                  copy number variation      :                3138          &lt;CN4&gt;,&lt;CN8&gt;
      
= Output  =
 
= Output  =
   −
Summarizes the variants in a VCF file
+
This is the annotated output of peek in the vt suite.
−
 
  −
<div class=" mw-collapsible mw-collapsed">
  −
  #summarizes the variants found in mills.vcf
  −
  vt peek mills.vcf
     −
<div class="mw-collapsible-content">
+
stats:no. of samples                    :          0 #number of genotype fields in VCF file, this is a site list so it is 0
−
   usage : vt peek [options] <in.vcf>
+
      no. of chromosomes                :        25 #no. of chromosomes observed in this file.<br>   
 +
      ========== Micro variants ========== <br>
 +
      no. of SNP                        :   54247827 #total number of SNPs
 +
          2 alleles                      :        53487808 (1.99) [35616038/17871770] #ts/tv ratio and the respective counts
 +
          3 alleles                      :          389190 (0.60) [291224/487156]
 +
          4 alleles                      :          370828 (0.50) [370828/741656]
 +
          >=5 alleles                    :              1 (0.33) [1/3]  <br>
 +
      no. of MNP                        :    122125
 +
          2 alleles                      :          121849 (1.56) [152383/97816]
 +
          3 alleles                      :            273 (0.89) [537/601]
 +
          4 alleles                      :              3 (1.00) [9/9] <br>
 +
      no. of Indel                      :    6600770    #also referred to as simple Indels
 +
          2 alleles                      :        6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts
 +
          3 alleles                      :          280892 (8.72) [503977/57807]
 +
          4 alleles                      :          28245 (131.19) [84094/641]
 +
          >=5 alleles                    :            5772 (3847.00) [23082/6] <br>
 +
      no. of SNP/MNP                    :      1161
 +
          3 alleles                      :            1143 (1.57) [1565/994]
 +
          4 alleles                      :              15 (1.36) [34/25]
 +
          >=5 alleles                    :              3 (0.67) [8/12] <br>
 +
      no. of SNP/Indel                  :    115153
 +
          2 alleles                      :          42717 (0.65) [16778/25939] (0.57) [15441/27276]  #ts/tv and ins/del ratios
 +
          3 alleles                      :          66401 (0.72) [29681/41397] (0.33) [31458/96168]
 +
          4 alleles                      :            4631 (0.55) [2420/4386] (0.25) [2602/10306]
 +
          >=5 alleles                    :           1404 (0.62) [1197/1926] (0.10) [513/4989] <br>
 +
      no. of MNP/Indel                  :      15619
 +
          2 alleles                      :          12820 (0.51) [12099/23648] (0.77) [5594/7226]
 +
          3 alleles                      :            2455 (0.40) [1796/4469] (0.45) [1144/2546]
 +
          4 alleles                      :            292 (0.24) [215/891] (1.42) [415/292]
 +
          >=5 alleles                    :              52 (0.43) [96/225] (2.47) [126/51] <br>
 +
      no. of SNP/MNP/Indel              :        273
 +
          3 alleles                      :            167 (0.63) [201/321] (0.38) [70/184]
 +
          4 alleles                      :              85 (0.35) [71/203] (0.28) [31/111]
 +
          >=5 alleles                    :              21 (0.35) [24/68] (0.68) [25/37]<br>
 +
      no. of MNP/Clumped                :      61175
 +
          2 alleles                      :          60617 (1.68) [84410/50220]
 +
          3 alleles                      :            549 (1.23) [1777/1449]
 +
          4 alleles                      :              8 (1.43) [53/37]
 +
          >=5 alleles                    :              1 (1.00) [5/5]  <br>
 +
      no. of SNP/MNP/Clumped            :        290
 +
          3 alleles                      :            282 (1.35) [665/494]
 +
          4 alleles                      :              8 (0.57) [13/23] <br>
 +
      no. of Indel/Clumped              :      27638
 +
          2 alleles                      :          25971 (0.65) [31435/48526] (0.79) [11444/14527]
 +
          3 alleles                      :            1585 (0.74) [3568/4793] (0.87) [1383/1582]
 +
          4 alleles                      :              70 (0.55) [96/175] (1.61) [124/77]
 +
          >=5 alleles                    :              12 (0.59) [37/63] (4.71) [33/7] <br>
 +
      no. of SNP/Indel/Clumped          :        456
 +
          3 alleles                      :            257 (0.84) [332/394] (0.33) [111/340]
 +
          4 alleles                      :            174 (0.38) [105/279] (0.58) [186/321]
 +
          >=5 alleles                    :              25 (0.19) [12/63] (0.94) [44/47] <br>
 +
      no. of MNP/Indel/Clumped          :        153
 +
          3 alleles                      :            138 (0.50) [233/466] (0.84) [102/122]
 +
          4 alleles                      :              12 (0.35) [14/40] (1.42) [17/12]
 +
          >=5 alleles                    :              3 (0.64) [7/11] (0.67) [4/6] <br>
 +
      no. of SNP/MNP/Indel/Clumped      :          6
 +
          4 alleles                      :              1 (3.00) [3/1] (0.00) [0/3]
 +
          >=5 alleles                    :              5 (0.62) [8/13] (2.00) [12/6] <br>
 +
      no. of Reference                  :          0 <br>
 +
      ====== Other useful categories ===== <br>
 +
      no. of Block Substitutions        :    184751 #equivalent to categories with allele lengths that are the same.
 +
          2 alleles                      :          182466 (1.60) [236793/148036]
 +
          3 alleles                      :            2247 (1.28) [4544/3538]
 +
          4 alleles                      :              34 (1.16) [109/94]
 +
          >=5 alleles                    :              4 (0.76) [13/17]  <br>
 +
      no. of Complex Substitutions      :    159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels
 +
          2 alleles                      :          81508 (0.61) [60312/98113] (0.66) [32479/49029]
 +
          3 alleles                      :          71003 (0.69) [35811/51840] (0.34) [34268/100942]
 +
          4 alleles                      :            5265 (0.49) [2924/5975] (0.30) [3375/11122]
 +
          >=5 alleles                    :            1522 (0.58) [1381/2369] (0.15) [757/5143] <br>
 +
      ======= Structural variants ========<br>
 +
      no. of structural variants        :      41217
 +
          2 alleles                      :          38079
 +
              deletion                  :                13135
 +
              insertion                  :                16451
 +
                  mobile element          :                    16253
 +
                    ALU                  :                        12513
 +
                    LINE1                :                        2911
 +
                    SVA                  :                          829
 +
                  numt                    :                      198
 +
              duplication                :                  664
 +
              inversion                  :                  100
 +
              copy number variation      :                7729
 +
          >=3 alleles                    :            3138
 +
              copy number variation      :                3138 <br>
 +
      ========= General summary ========== <br>
 +
      no. of observed variants          :  79449759
 +
      no. of unclassified variants      :          0
   −
  options : -o  output VCF file [-]
+
= Implementation =
−
            -I  file containing list of intervals []
  −
            -i  intervals []
  −
            -r  reference sequence fasta file []
  −
            --  ignores the rest of the labeled arguments following this flag
  −
            -h  displays help
  −
</div>
  −
</div>
     −
#This is a sample output of a peek command which summarizes the variants found in a VCF file.
+
This is implemented in [http://genome.sph.umich.edu/wiki/Vt#Peek vt].
−
  stats: no. of samples                    :          0
  −
          no. of chromosomes                :        22<br>
  −
          ========== Micro variants ==========<br>
  −
          no. of SNPs                        :  77228885
  −
              2 alleles (ts/tv)              :        77011302 (2.11) [52287790/24723512]
  −
              3 alleles (ts/tv)              :         216560 (0.75) [185520/247600]
  −
              4 alleles (ts/tv)              :            1023 (0.50) [1023/2046]<br>
  −
          no. of MNPs                        :          0
  −
              2 alleles (ts/tv)              :              0 (-nan) [0/0]
  −
              >=3 alleles (ts/tv)            :              0 (-nan) [0/0]<br>
  −
          no. Indels                        :    2147564
  −
              2 alleles (ins/del)            :        2124842 (0.47) [683250/1441592]
  −
              >=3 alleles (ins/del)          :          22722 (2.12) [32411/15286]<br>
  −
          no. SNP/MNP                        :          0
  −
              3 alleles (ts/tv)              :              0 (-nan) [0/0]
  −
              >=4 alleles (ts/tv)            :              0 (-nan) [0/0] <br>
  −
          no. SNP/Indels                    :      12913
  −
              2 alleles (ts/tv) (ins/del)    :            412 (0.41) [120/292] (3.68) [324/88]
  −
              >=3 alleles (ts/tv) (ins/del)  :          12501 (0.43) [7670/17649] (18.64) [12434/667]<br>
  −
          no. MNP/Indels                    :        153
  −
              2 alleles (ts/tv) (ins/del)    :              0 (-nan) [0/0] (-nan) [0/0]
  −
              >=3 alleles (ts/tv) (ins/del)  :            153 (0.30) [138/465] (0.27) [67/248]<br>
  −
          no. SNP/MNP/Indels                :          2
  −
              3 alleles (ts/tv) (ins/del)    :              0 (-nan) [0/0] (-nan) [0/0]
  −
              4 alleles (ts/tv) (ins/del)    :              2 (0.00) [3/5] (1.00) [3/3]
  −
              >=5 alleles (ts/tv) (ins/del)  :              0 (-nan) [0/0] (-nan) [0/0]<br>
  −
          no. of clumped variants            :      19025
  −
              2 alleles                      :              0 (-nan) [0/0] (-nan) [0/0]
  −
              3 alleles                      :          18508 (0.16) [12152/75366] (0.00) [93/18653]
  −
              4 alleles                      :            451 (0.15) [369/2390] (0.33) [201/609]
  −
              >=5 alleles                    :              66 (0.09) [37/414] (1.19) [107/90]<br>
  −
          ====== Other useful categories =====<br>
  −
          no. complex variants              :      32093
  −
              2 alleles (ts/tv) (ins/del)    :            412 (0.41) [120/292] (3.68) [324/88]
  −
              >=3 alleles (ts/tv) (ins/del)  :          31681 (0.21) [20369/96289] (0.64) [12905/20270]<br>
  −
          ======= Structural variants ========<br>
  −
          no. of structural variants        :      41217
  −
              2 alleles                      :          38079
  −
                  deletion                  :                13135
  −
                  insertion                  :                16451
  −
                    mobile element          :                    16253
  −
                        ALU                  :                        12513
  −
                        LINE1                :                        2911
  −
                        SVA                  :                          829
  −
                    numt                    :                      198
  −
                  duplication                :                  664
  −
                  inversion                  :                  100
  −
                  copy number variation      :                7729
  −
              >=3 alleles                    :            3138
  −
                  copy number variation      :                3138 <br>
  −
          ========= General summary ========== <br>
  −
          no. of reference                  :          0 <br>
  −
          no. of observed variants          :  79449759
  −
          no. of unclassified variants      :          0
      
= Maintained by =
 
= Maintained by =
    
This page is maintained by  [mailto:atks@umich.edu Adrian].
 
This page is maintained by  [mailto:atks@umich.edu Adrian].
Atks
1,102

edits

Retrieved from "http://genome.sph.umich.edu/wiki/Special:MobileDiff/11465...14115"

Navigation menu