<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
	<id>http://genome.sph.umich.edu/w/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Ttbek</id>
	<title>Genome Analysis Wiki - User contributions [en]</title>
	<link rel="self" type="application/atom+xml" href="http://genome.sph.umich.edu/w/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Ttbek"/>
	<link rel="alternate" type="text/html" href="http://genome.sph.umich.edu/wiki/Special:Contributions/Ttbek"/>
	<updated>2026-09-26T00:42:15Z</updated>
	<subtitle>User contributions</subtitle>
	<generator>MediaWiki 1.43.1</generator>
	<entry>
		<id>http://genome.sph.umich.edu/w/index.php?title=Vt&amp;diff=15150</id>
		<title>Vt</title>
		<link rel="alternate" type="text/html" href="http://genome.sph.umich.edu/w/index.php?title=Vt&amp;diff=15150"/>
		<updated>2020-06-10T00:09:34Z</updated>

		<summary type="html">&lt;p&gt;Ttbek: /* Remove overlap */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;= Introduction =&lt;br /&gt;
&lt;br /&gt;
vt is a variant tool set that discovers short variants from Next Generation Sequencing data.&lt;br /&gt;
&lt;br /&gt;
= Installation =&lt;br /&gt;
&lt;br /&gt;
== General ==&lt;br /&gt;
&lt;br /&gt;
The source files are housed in github.  [https://github.com/samtools/htslib htslib] is &lt;br /&gt;
used and a copy of a developmental freeze is stored as part of the vt repository to &lt;br /&gt;
ensure compatibility.&lt;br /&gt;
&lt;br /&gt;
To install, perform the following steps:&lt;br /&gt;
&lt;br /&gt;
  #this will create a directory named vt in the directory you cloned the repository&lt;br /&gt;
  1. git clone https://github.com/atks/vt.git  &amp;lt;br&amp;gt;&lt;br /&gt;
  #change directory to vt&lt;br /&gt;
  2. cd vt &amp;lt;br&amp;gt;&lt;br /&gt;
  #run make, note that compilers need to support the c++0x standard &lt;br /&gt;
  3. make &amp;lt;br&amp;gt;&lt;br /&gt;
  #you can test the build&lt;br /&gt;
  4. make test&lt;br /&gt;
  &amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   An expected output when all is well for the tests is shown here. (click expand =&amp;gt;)&lt;br /&gt;
  &amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  user@server:~/vt$ make test&lt;br /&gt;
  test/test.sh&lt;br /&gt;
  ++++++++++++++++++++++&lt;br /&gt;
  Tests for vt normalize&lt;br /&gt;
  ++++++++++++++++++++++&lt;br /&gt;
  testing normalize&lt;br /&gt;
               output VCF file : ok&lt;br /&gt;
               output logs     : ok&lt;br /&gt;
  +++++++++++++++++++++++++++++++&lt;br /&gt;
  Tests for vt decompose_blocksub&lt;br /&gt;
  +++++++++++++++++++++++++++++++&lt;br /&gt;
  testing decompose_blocksub of even-length blocks&lt;br /&gt;
               output VCF file : ok&lt;br /&gt;
               output logs     : ok&lt;br /&gt;
  testing decompose_blocksub with alignment&lt;br /&gt;
               output VCF file : ok&lt;br /&gt;
               output logs     : ok&lt;br /&gt;
  testing decompose_blocksub of phased even-length blocks&lt;br /&gt;
               output VCF file : ok&lt;br /&gt;
               output logs     : ok&lt;br /&gt;
  ++++++++++++++++++++++&lt;br /&gt;
  Tests for vt decompose&lt;br /&gt;
  ++++++++++++++++++++++&lt;br /&gt;
  testing decompose for a triallelic variant&lt;br /&gt;
               output VCF file : ok&lt;br /&gt;
               output logs     : ok &amp;lt;br&amp;gt;&lt;br /&gt;
  Passed tests : 5 / 5&lt;br /&gt;
   &amp;lt;/div&amp;gt;&lt;br /&gt;
  &amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Mac ===&lt;br /&gt;
&lt;br /&gt;
You may install vt via homebrew.&lt;br /&gt;
&lt;br /&gt;
   brew tap brewsci/bio&lt;br /&gt;
   brew tap brewsci/science&lt;br /&gt;
   &lt;br /&gt;
   brew install brewsci/bio/vt&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Building has been tested on Linux and Mac systems on gcc 4.8.1 and clang 3.4. &amp;lt;br&amp;gt;&lt;br /&gt;
Some features of C++11 are used, thus there is a need for newer versions of gcc and clang.&lt;br /&gt;
&lt;br /&gt;
= Updating =&lt;br /&gt;
&lt;br /&gt;
vt is currently under heavy development, you will probably need to update often.&lt;br /&gt;
&lt;br /&gt;
  #remove all object files&lt;br /&gt;
  #you need to do this as source files as the static libraries might have changed and need to be removed.&lt;br /&gt;
  1. make clean &amp;lt;br&amp;gt;&lt;br /&gt;
  #update source files&lt;br /&gt;
  2. git pull &amp;lt;br&amp;gt;&lt;br /&gt;
  #compile and link, the -j option tells Makefile to run up to 40 independent commands in parallel&lt;br /&gt;
  3. make -j 40&lt;br /&gt;
&lt;br /&gt;
= General Features and notes =&lt;br /&gt;
&lt;br /&gt;
== Common options ==&lt;br /&gt;
&lt;br /&gt;
    -i   multiple intervals in &amp;lt;seq&amp;gt;:&amp;lt;start&amp;gt;-&amp;lt;end&amp;gt; format delimited by commas.&lt;br /&gt;
&lt;br /&gt;
    -I   multiple intervals in &amp;lt;seq&amp;gt;:&amp;lt;start&amp;gt;-&amp;lt;end&amp;gt; format listed in a text file line by line.&lt;br /&gt;
&lt;br /&gt;
    -o   defines the out file which and has the STDOUT set as the default.&lt;br /&gt;
         vt recognizes the appropriate output by file extension.&lt;br /&gt;
         &amp;lt;name&amp;gt;.vcf     - uncompressed VCF&lt;br /&gt;
         &amp;lt;name&amp;gt;.vcf.gz  - compressed VCF&lt;br /&gt;
         &amp;lt;name&amp;gt;.bcf     - BCF&lt;br /&gt;
         You may modify the STDOUT to output the binary version of the format.  Uncompressed&lt;br /&gt;
         VCF and BCF streams are indicated by - and + respectively.  &lt;br /&gt;
&lt;br /&gt;
    -f  filter expression&lt;br /&gt;
&lt;br /&gt;
    -s  sequential region selection as opposed to random access of regions specified by the i option.&lt;br /&gt;
        This is useful when you want to select many close-by regions, while the -i option works,&lt;br /&gt;
        it is less efficient and also selects a variant multiple times if it overlaps 2 regions.  This &lt;br /&gt;
        option iterates through the variants in the file sequentially and checks for overlap with the &lt;br /&gt;
        bed file given.&lt;br /&gt;
&lt;br /&gt;
== Uncompressed BCF streams ==&lt;br /&gt;
&lt;br /&gt;
htslib is designed with BCF as the underlying data structure  and it has incorporated &lt;br /&gt;
awareness of uncompressed BCF streams in the i/o API.  One may use this feature to &lt;br /&gt;
stream uncompressed BCF records to save on computational time spent on (de)compression.&lt;br /&gt;
&lt;br /&gt;
  #using textual VCF streams indicated by -&lt;br /&gt;
  cat mills.vcf | vt normalize - -r hs37d5.fa | vt uniq - -o out.bcf&lt;br /&gt;
&lt;br /&gt;
  #using uncompressed BCF streams indicated by +&lt;br /&gt;
  cat mills.vcf | vt normalize - -r hs37d5.fa -o + | vt uniq + -o out.bcf&lt;br /&gt;
&lt;br /&gt;
In this example, the former took 0.84s while the latter took 0.64s to process. (24% speed up!)&lt;br /&gt;
&lt;br /&gt;
== Filters ==&lt;br /&gt;
&lt;br /&gt;
For some programs. you may define a filter via the -f option.&lt;br /&gt;
&lt;br /&gt;
  This allows you to only analyse biallelic indels that are passed on chromosome 20.&lt;br /&gt;
  vt profile_na12878 vt.bcf -g na12878.reference.txt -r genome.fa -f &amp;quot;N_ALLELE==2&amp;amp;&amp;amp;VTYPE==INDEL&amp;amp;&amp;amp;PASS&amp;quot;  -i 20&lt;br /&gt;
&lt;br /&gt;
  This allows you to extract biallelic indels that are passed on chromosome 20.&lt;br /&gt;
  vt view vt.bcf -f &amp;quot;N_ALLELE==2&amp;amp;&amp;amp;VTYPE==INDEL&amp;amp;&amp;amp;PASS&amp;quot;  -i 20&lt;br /&gt;
&lt;br /&gt;
Other examples of filters&lt;br /&gt;
&lt;br /&gt;
  #all variants with a SNP in them&lt;br /&gt;
  VTYPE&amp;amp;SNP&lt;br /&gt;
  #Simple insertions of length 1&lt;br /&gt;
  VTYPE==INDEL&amp;amp;&amp;amp;DLEN==1&lt;br /&gt;
  #Indels of length 1&lt;br /&gt;
  VTYPE==INDEL&amp;amp;&amp;amp;LEN==1&lt;br /&gt;
&lt;br /&gt;
  Variant characteristics&lt;br /&gt;
    VTYPE,N_ALLELE,DLEN,LEN,VARIANT_CONTAINS_N&lt;br /&gt;
&lt;br /&gt;
  Variant value types&lt;br /&gt;
    SNP,MNP,INDEL,CLUMPED&lt;br /&gt;
&lt;br /&gt;
  Biallelic SNPs only                         : VTYPE==SNP&amp;amp;&amp;amp;N_ALLELE==2&lt;br /&gt;
  Biallelic Indels with embedded SNP          : VTYPE==(SNP|INDEL)&amp;amp;&amp;amp;N_ALLELE==2&lt;br /&gt;
  Biallelic variants involving insertions     : VTYPE&amp;amp;INDEL&amp;amp;&amp;amp;DLEN&amp;gt;0&amp;amp;&amp;amp;N_ALLELE==2&lt;br /&gt;
  Biallelic variants involving 1bp variants   : LEN==1&amp;amp;&amp;amp;N_ALLELE==2&lt;br /&gt;
  Variants with explicit sequences with no Ns : ~VARIANT_CONTAINS_N &lt;br /&gt;
&lt;br /&gt;
  REF field&lt;br /&gt;
    REF&lt;br /&gt;
&lt;br /&gt;
  ALT field&lt;br /&gt;
    ALT&lt;br /&gt;
&lt;br /&gt;
  QUAL field&lt;br /&gt;
    QUAL&lt;br /&gt;
&lt;br /&gt;
  FILTER fields&lt;br /&gt;
    PASS, FILTER.&amp;lt;tag&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  INFO fields&lt;br /&gt;
    INFO.&amp;lt;tag&amp;gt;&lt;br /&gt;
  &lt;br /&gt;
  A/C SNPs                                    : REF==&#039;A&#039; &amp;amp;&amp;amp; ALT==&#039;C&#039;&lt;br /&gt;
  AC type of STRs                             : REF=~&#039;^.(AC)+$&#039; || ALT=~&#039;^.(AC)+$&#039;&lt;br /&gt;
  Passed biallelic SNPs only                  : PASS&amp;amp;&amp;amp;VTYPE==SNP&amp;amp;&amp;amp;N_ALLELE==2&lt;br /&gt;
  Passed Common biallelic SNPs only           : PASS&amp;amp;&amp;amp;VTYPE==SNP&amp;amp;&amp;amp;N_ALLELE==2&amp;amp;&amp;amp;INFO.AF&amp;gt;0.005&lt;br /&gt;
  Passed Common biallelic SNPs or rare indels : (PASS&amp;amp;&amp;amp;VTYPE==SNP&amp;amp;&amp;amp;N_ALLELE==2&amp;amp;&amp;amp;INFO.AF&amp;gt;0.005)||(VTYPE&amp;amp;INDEL&amp;amp;&amp;amp;INFO.AF&amp;lt;=0.005)&lt;br /&gt;
  Passed Common biallelic SNPs or rare indels : ((PASS&amp;amp;&amp;amp;VTYPE==SNP&amp;amp;&amp;amp;N_ALLELE==2&amp;amp;&amp;amp;INFO.AF&amp;gt;0.005)||(VTYPE&amp;amp;INDEL&amp;amp;&amp;amp;INFO.AF&amp;lt;=0.005))&amp;amp;&amp;amp;QUAL&amp;gt;100&lt;br /&gt;
  with quality greater than 100&lt;br /&gt;
  Failed rare variants : ~PASS&amp;amp;&amp;amp;(INFO.AC/INFO.AN&amp;lt;0.005)&lt;br /&gt;
&lt;br /&gt;
  [http://www.pcre.org/current/doc/html/pcre2pattern.html#SEC1 Regular expression] matching PERL style (implemented with pcre2)  &lt;br /&gt;
  Sometimes, an info field will contain several values in a string with functional annotation, to match what you want,&lt;br /&gt;
  just use INFO.ANNO=~&#039;&amp;lt;perl regular expression&amp;gt;&#039;&lt;br /&gt;
&lt;br /&gt;
  Passed variants in intergenic regions or UTR                    : PASS&amp;amp;&amp;amp;INFO.ANNO=~&#039;Intergenic|UTR&#039;&lt;br /&gt;
  Passed variants in intergenic regions or UTR ignoring case      : PASS&amp;amp;&amp;amp;INFO.ANNO=~&#039;(?i)Intergenic|UTR&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
  pcre2&#039;s &#039;(?i)Intergenic|UTR&#039; is equivalent to PERL&#039;s &#039;/intergenic|UTR/i&#039;&lt;br /&gt;
&lt;br /&gt;
  Operations&lt;br /&gt;
  == : equivalence for strings and numbers&lt;br /&gt;
  != : not equal&lt;br /&gt;
  =~ : regular expression match for strings only&lt;br /&gt;
  ~~ : not of =~.  Is equivalent to PERL&#039;s !~, this notation is used as BASH keeps interpreting ! for recalling commands from the history&lt;br /&gt;
  ~  : logical not&lt;br /&gt;
  &amp;amp;&amp;amp; : logical and&lt;br /&gt;
  || : logical or&lt;br /&gt;
  &amp;amp;  : bitwise and&lt;br /&gt;
  |  : bitwise or&lt;br /&gt;
  +  : add&lt;br /&gt;
  -  : subtract&lt;br /&gt;
  *  : multiply&lt;br /&gt;
  /  : divide&lt;br /&gt;
  &lt;br /&gt;
The following programs support filter expressions.&lt;br /&gt;
&lt;br /&gt;
* view&lt;br /&gt;
* peek&lt;br /&gt;
* profile_snps&lt;br /&gt;
* profile_indels&lt;br /&gt;
* profile_na12878&lt;br /&gt;
* profile_mendelian&lt;br /&gt;
* profile_len&lt;br /&gt;
* profile_chrom&lt;br /&gt;
* profile_afs&lt;br /&gt;
* profile_hwe&lt;br /&gt;
* concordance&lt;br /&gt;
* partition&lt;br /&gt;
&lt;br /&gt;
== Alternate headers ==&lt;br /&gt;
&lt;br /&gt;
  As BCF is a restrictive format of VCF where all meta data must be present in the header, &lt;br /&gt;
  vt provides a mechanism to read an alternative header for VCF files that do not have a &lt;br /&gt;
  well formed header.  Simply provide a header file stub named as &amp;lt;vcf-file&amp;gt;.hdr and vt&lt;br /&gt;
  will automatically read it instead of the original header in &amp;lt;vcf-file&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
  For more information about VCF/BCF : http://samtools.github.io/hts-specs/VCFv4.2.pdf&lt;br /&gt;
&lt;br /&gt;
  &amp;lt;span style=&amp;quot;color:#FF0000&amp;quot;&amp;gt;This mechanism is available only if one is reading VCF or compressed VCF files.  It is&lt;br /&gt;
  disabled for BCF files as this might corrupt the BCF file because the encoding of the &lt;br /&gt;
  fields in BCF records is based on the order of the meta info lines in the header.&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  &amp;lt;span style=&amp;quot;color:#0000FF&amp;quot;&amp;gt;Note: BCF2.2 introduces the IDX field in meta information lines that indicates the &lt;br /&gt;
  dictionary encoding. This feature might be enabled for BCF files in the future.&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== General cases of Ploidy and Alleles ==&lt;br /&gt;
&lt;br /&gt;
  I am trying to make vt handle [http://genome.sph.umich.edu/wiki/Relationship_between_Ploidy,_Alleles_and_Genotypes general cases of ploidy and alleles].  &lt;br /&gt;
  Please let me know if that is lacking in a tool that you are using.&lt;br /&gt;
&lt;br /&gt;
== BCF Compression Levels vs Compression Time ==&lt;br /&gt;
&lt;br /&gt;
The zlib deflation algorithm (a variant of LZ77) has 10 levels - 0 to 9.  0 has no compression but instead wraps &amp;lt;br&amp;gt;&lt;br /&gt;
up the file in zlib or bgzf blocks.  It may be useful to have 0 compression as it is indexable with the same mechanism &amp;lt;br&amp;gt;&lt;br /&gt;
used for compressed files.  Levels 1-9 denote an increasing compression level in exchange for longer times for &amp;lt;br&amp;gt;&lt;br /&gt;
compression.&lt;br /&gt;
&lt;br /&gt;
In general, zlib compression does not have significant differences in compression for BCF files between the 9 compression &amp;lt;br&amp;gt;&lt;br /&gt;
levels as shown in the following table:&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! scope=&amp;quot;col&amp;quot;| Compression Level&lt;br /&gt;
! scope=&amp;quot;col&amp;quot;| Size&lt;br /&gt;
! scope=&amp;quot;col&amp;quot;| Time&lt;br /&gt;
|-&lt;br /&gt;
|0&amp;lt;br&amp;gt;&lt;br /&gt;
1&amp;lt;br&amp;gt;&lt;br /&gt;
2&amp;lt;br&amp;gt;&lt;br /&gt;
3&amp;lt;br&amp;gt;&lt;br /&gt;
4&amp;lt;br&amp;gt;&lt;br /&gt;
5&amp;lt;br&amp;gt;&lt;br /&gt;
6 (default) &amp;lt;br&amp;gt;&lt;br /&gt;
7&amp;lt;br&amp;gt;&lt;br /&gt;
8&amp;lt;br&amp;gt;&lt;br /&gt;
9&lt;br /&gt;
|153GB &amp;lt;br&amp;gt;&lt;br /&gt;
98.4GB &amp;lt;br&amp;gt;&lt;br /&gt;
98.0GB &amp;lt;br&amp;gt;&lt;br /&gt;
97.5GB &amp;lt;br&amp;gt;&lt;br /&gt;
95.5GB &amp;lt;br&amp;gt;&lt;br /&gt;
95.2GB &amp;lt;br&amp;gt;&lt;br /&gt;
94.9GB &amp;lt;br&amp;gt;&lt;br /&gt;
94.8GB &amp;lt;br&amp;gt;&lt;br /&gt;
94.76GB &amp;lt;br&amp;gt;&lt;br /&gt;
94.75GB&lt;br /&gt;
|45m&amp;lt;br&amp;gt;&lt;br /&gt;
2h3m &amp;lt;br&amp;gt;&lt;br /&gt;
2h7m &amp;lt;br&amp;gt;&lt;br /&gt;
2h12m &amp;lt;br&amp;gt;&lt;br /&gt;
2h26m &amp;lt;br&amp;gt;&lt;br /&gt;
2h54m &amp;lt;br&amp;gt;&lt;br /&gt;
3h19m &amp;lt;br&amp;gt;&lt;br /&gt;
3h41m &amp;lt;br&amp;gt;&lt;br /&gt;
4h5m &amp;lt;br&amp;gt;&lt;br /&gt;
4h25m&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;span style=&amp;quot;color:#0000FF&amp;quot;&amp;gt;So, it might be a good idea to compress at lower levels when dealing with large temporary &amp;lt;br&amp;gt; &lt;br /&gt;
files in a pipeline to save compute time.  This can be achieved with the -c option in vt view&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
= VCF Manipulation =&lt;br /&gt;
&lt;br /&gt;
=== View ===&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Views a VCF or VCF.GZ or BCF file.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #views mills.bcf and outputs to standard out&lt;br /&gt;
   vt view -h mills.bcf &lt;br /&gt;
&lt;br /&gt;
   #views mills.bcf and locally sorts it in a 10000bp window and outputs to sorted-millsbcf&lt;br /&gt;
   vt view -h -w 10000 mills.bcf -o sorted-mills.bcf&lt;br /&gt;
&lt;br /&gt;
   #views mills.bcf and outputs to c1-mills.bcf with a compression level of 1.  By default, &lt;br /&gt;
   #the compression level is 6 where lower levels compress the file less but are faster. &lt;br /&gt;
   #The difference in compression for BCF files between level 1 to level 9 is about 5% of &lt;br /&gt;
   #of a level 1 compression file.  The difference in time taken is about an additional 50%&lt;br /&gt;
   #of a level 1 compression.  The levels range from 0 to 9 where 0 means no compression &lt;br /&gt;
   #but the file is encapsulated in bgzf blocks that allows the file to be indexed.  A special &lt;br /&gt;
   #level -1 denotes an uncompressed BCF file that is not encapsulated in bgzf blocks and &lt;br /&gt;
   #are thus not indexable but are highly suitable for streaming between vt commands.&lt;br /&gt;
   vt view -h mills.bcf -c 1 -o c1-mills.bcf&lt;br /&gt;
&lt;br /&gt;
   #views mills.bcf and selects variants that overlap with the regions found in dust.bed from chromosome 20&lt;br /&gt;
   #the -t option selects variants by checking if each variant overlaps with the regions in the bed file, this is&lt;br /&gt;
   #as opposed to random accessing the variants via the index through the intervals defined in -i and -I options.&lt;br /&gt;
   #this is useful when selecting variants from the target regions from an exome sequencing experiment.&lt;br /&gt;
   vt view 10000 mills.bcf -t dust.bed -i 20&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt view [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -o  output VCF/VCF.GZ/BCF file [-]&lt;br /&gt;
            -f  filter expression []&lt;br /&gt;
            -w  local sorting window size [0]&lt;br /&gt;
            -s  print site information only without genotypes [false]&lt;br /&gt;
            -H  print header only, this option is honored only for STDOUT [false]&lt;br /&gt;
            -h  omit header, this option is honored only for STDOUT [false]&lt;br /&gt;
            -p  print options and summary []&lt;br /&gt;
            -r  right window size for overlap []&lt;br /&gt;
            -l  left window size for overlap []&lt;br /&gt;
            -c  compression level 0-9, 0 and -1 denotes uncompressed with the former being wrapped in bgzf. [6]&lt;br /&gt;
            -t  bed file for variant selection via streaming []&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Index ===&lt;br /&gt;
&lt;br /&gt;
Indexes a VCF.GZ or BCF file.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #indexes mills.bcf&lt;br /&gt;
   vt index mills.bcf &lt;br /&gt;
   #indexes mills.vcf.gz&lt;br /&gt;
   vt index mills.vcf.gz &lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt index [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -p  print options and summary []&lt;br /&gt;
            --  ignores the rest of the labeled arguments following this flag&lt;br /&gt;
            -h  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Sorting ===&lt;br /&gt;
&lt;br /&gt;
Sorting may be done in 3 approaches.&lt;br /&gt;
&lt;br /&gt;
Locally:&amp;lt;br&amp;gt;&lt;br /&gt;
Performs sorting within a local window.  The window size may be set by the -w option. The default window size &amp;lt;br&amp;gt;&lt;br /&gt;
is 1000bp and if a record is detected to be potentially out of order due to a small window size, it wil be reported.&amp;lt;br&amp;gt;&lt;br /&gt;
Use this when your VCF records are grouped by chromosome but not ordered in short stretches.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
By chromosome: &amp;lt;br&amp;gt;&lt;br /&gt;
Your VCF file is not ordered by the chromosomes in the header but is fully ordered within each chromosome.&amp;lt;br&amp;gt;&lt;br /&gt;
The VCF file should be indexed and vt will output the records in the order of chromosomes given in the header. &amp;lt;br&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Full sort [default option]: &amp;lt;br&amp;gt;&lt;br /&gt;
No assumptions are made about the VCF file.  Records will be ordered by the order of contigs in the header.  &amp;lt;br&amp;gt;&lt;br /&gt;
Smaller temporary ordered files are created and their names are &amp;lt;output_vcf&amp;gt;.&amp;lt;no&amp;gt;.bcf and after generating &amp;lt;br&amp;gt;&lt;br /&gt;
these files, they are merged and output into &amp;lt;output_vcf&amp;gt;.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #sorts mills.bcf and outputs to standard out in a 1000bp window.&lt;br /&gt;
   vt sort -m local mills.bcf &lt;br /&gt;
   #sorts mills.bcf and locally sorts it in a 10000bp window and outputs to out.bcf&lt;br /&gt;
   vt sort -m local -w 10000 mills.bcf -o out.bcf &lt;br /&gt;
   #sorts an indexed mills.bcf  with chromosomes not sorted in the contig order in the header &lt;br /&gt;
   vt sort -m chrom  mills.bcf -o out.bcf &lt;br /&gt;
   #sorts mills.bcf with no assumption&lt;br /&gt;
   vt sort mills.bcf -o out.bcf &lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt sort [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -m  sorting modes. [full]&lt;br /&gt;
                local : locally sort within a 1000bp window.  Window size may be set by -w.&lt;br /&gt;
                chrom : sort chromosomes based on order of contigs in header.&lt;br /&gt;
                        input must be indexed.&lt;br /&gt;
                full  : full sort with no assumptions.&lt;br /&gt;
            -o  output VCF/VCF.GZ/BCF file. [-]&lt;br /&gt;
            -w  local sorting window size, set by default to 1000 under local mode. [0]&lt;br /&gt;
            -p  print options and summary. []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Normalization ===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div&amp;gt;&lt;br /&gt;
[http://genome.sph.umich.edu/wiki/Variant_Normalization Normalize] variants in a [http://www.1000genomes.org/wiki/analysis/variant-call-format/vcf-variant-call-format-version-42 VCF]  file [http://bioinformatics.oxfordjournals.org/content/31/13/2202 (Tan et al. 2015)] .  Normalized variants may have their positions changed; in such cases, the normalized variants&lt;br /&gt;
are reordered and output in an ordered fashion.  The local reordering takes place over a window of 10000 base pairs which may be changed via the -w option.  There is an underlying assumption that the REF&lt;br /&gt;
field is consistent with the reference sequence use, vt will check for this and will fail if reference inconsistency is encountered; this may be relaexd with the -n option.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #normalize variants and write out to dbsnp.normalized.vcf&lt;br /&gt;
   vt normalize dbsnp.vcf -r seq.fa -o dbsnp.normalized.vcf&lt;br /&gt;
&lt;br /&gt;
   #normalize variants, send to standard out and remove duplicates.&lt;br /&gt;
   vt normalize dbsnp.vcf -r seq.fa | vt uniq - -o dbsnp.normalized.uniq.vcf&lt;br /&gt;
&lt;br /&gt;
   #read in variants that do not contain N in the explicit alleles, normalize variants, send to standard out.&lt;br /&gt;
   vt normalize dbsnp.vcf -r seq.fa -f &amp;quot;~VARIANT_CONTAINS_N&amp;quot;&lt;br /&gt;
&lt;br /&gt;
   #variants that are normalized will be annotated with an OLD_VARIANT info tag.&lt;br /&gt;
   #CHROM  POS      ID   REF           ALT  QUAL  FILTER  INFO&lt;br /&gt;
   19	  29238772 .	C             G    .     PASS	 VT=SNP;OLD_VARIANT=19:29238771:TC/TG&lt;br /&gt;
   20	  60674709 .	GCCCAGCCCCAC  G    .     PASS	 VT=INDEL;OLD_VARIANT=20:60674718:CACCCCAGCCCC/C&lt;br /&gt;
&lt;br /&gt;
   #this shows a sample output with the normalization operations that were used &lt;br /&gt;
   #categorized into 5 categories each for biallelic and multiallelic variants. &amp;lt;br&amp;gt;&lt;br /&gt;
   stats: biallelic&lt;br /&gt;
          no. left trimmed                      : 156908&lt;br /&gt;
          no. right trimmed                     : 323&lt;br /&gt;
          no. left and right trimmed            : 33&lt;br /&gt;
          no. right trimmed and left aligned    : 7&lt;br /&gt;
          no. left aligned                      : 12360 &amp;lt;br&amp;gt;&lt;br /&gt;
       total no. biallelic normalized           : 169631 &amp;lt;br&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
       multiallelic&lt;br /&gt;
          no. left trimmed                      : 627189&lt;br /&gt;
          no. right trimmed                     : 2509&lt;br /&gt;
          no. left and right trimmed            : 1498&lt;br /&gt;
          no. right trimmed and left aligned    : 212&lt;br /&gt;
          no. left aligned                      : 1783 &amp;lt;br&amp;gt;&lt;br /&gt;
       total no. multiallelic normalized        : 633191 &amp;lt;br&amp;gt;&lt;br /&gt;
       total no. variants normalized            : 802822&lt;br /&gt;
       total no. variants observed              : 88052639&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
   usage : vt normalize [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -o  output VCF file [-]&lt;br /&gt;
            -d  debug [false]&lt;br /&gt;
            -q  do not print options and summary [false]&lt;br /&gt;
            -m  warns but does not exit when REF is inconsistent&lt;br /&gt;
                with masked reference sequence for non SNPs.&lt;br /&gt;
                This overides the -n option [false]&lt;br /&gt;
            -n  warns but does not exit when REF is inconsistent&lt;br /&gt;
                with reference sequence for non SNPs [false]&lt;br /&gt;
            -w  window size for local sorting of variants [10000]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Decompose biallelic block substitutions ===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div&amp;gt;&lt;br /&gt;
Decomposes biallelic block substitutions into its constituent SNPs.   &amp;lt;br&amp;gt;&lt;br /&gt;
There is now an additional option -a which decomposes non block substitutions into its constituent SNPs and indels. (kindly added by [[https://github.com/holtgrewe holtgrewe@github]]) &amp;lt;br&amp;gt;&lt;br /&gt;
There is no exact solution and this decomposition is based on the best guess outcome using a Needleman-Wunsch algorithm. &amp;lt;br&amp;gt;&lt;br /&gt;
You might also want to check out [https://github.com/vcflib/vcflib#vcfallelicprimitives vcfallelicprimitives]. &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
There is now an additional option -m and -d which ensures that some MNVs are not decomposed. (kindly added by [[https://github.com/jaudoux jaudoux@github]]) &amp;lt;br&amp;gt;&lt;br /&gt;
The motivation is from&amp;lt;br&amp;gt;&lt;br /&gt;
*Exome-wide assessment of the functional impact and pathogenicity of multi-nucleotide mutations https://www.biorxiv.org/content/10.1101/258723v2.full&amp;lt;br&amp;gt;&lt;br /&gt;
*Landscape of multi-nucleotide variants in 125,748 human exomes and 15,708 genomes https://www.biorxiv.org/content/10.1101/573378v2.full&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #decomposes biallelic block substitutions and write out to decomposed_blocksub.vcf&lt;br /&gt;
   vt decompose_blocksub gatk.vcf -o decomposed_blocksub.vcf &amp;lt;br&amp;gt;&lt;br /&gt;
   #before decomposition&lt;br /&gt;
   #CHROM  POS     ID    REF     ALT     QUAL    FILTER  INFO            FORMAT  S1                                                                          &lt;br /&gt;
   20	  763837  .	CA	TG	50340.1	PASS	AC=1;AN=2	GT	0|1	&amp;lt;br&amp;gt;&lt;br /&gt;
   #after decomposition&lt;br /&gt;
   #CHROM  POS     ID    REF     ALT     QUAL    FILTER  INFO                                    FORMAT  S1         &lt;br /&gt;
   20	  763837  .	C	T	50340.1	PASS	AC=1;AN=2;OLD_CLUMPED=20:763837:CA/TG	GT	0|1&lt;br /&gt;
   20	  763838  .	A	G	50340.1	PASS	AC=1;AN=2;OLD_CLUMPED=20:763837:CA/TG	GT	0|1&lt;br /&gt;
&lt;br /&gt;
   #decomposes biallelic clumped variant and write out to decomposed_blocksub.vcf&lt;br /&gt;
   vt decompose_blocksub -a gatk.vcf -o decomposed_blocksub.vcf &amp;lt;br&amp;gt;&lt;br /&gt;
   #before decomposition&lt;br /&gt;
   #CHROM  POS     ID    REF     ALT     QUAL    FILTER  INFO            FORMAT  S1                                                                          &lt;br /&gt;
   20	  763837  .	CG	TGA	50340.1	PASS	AC=1;AN=2	GT	0|1	&amp;lt;br&amp;gt;&lt;br /&gt;
   #after decomposition&lt;br /&gt;
   #CHROM  POS     ID    REF     ALT     QUAL    FILTER  INFO                                    FORMAT  S1         &lt;br /&gt;
   20	  763837  .	C	T	50340.1	PASS	AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA	GT	0|1&lt;br /&gt;
   20	  763838  .	G	GA	50340.1	PASS	AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA	GT	0|1&lt;br /&gt;
&lt;br /&gt;
   #decomposes biallelic clumped variant and write out to decomposed_blocksub.vcf and add phase set information in the genotype fields&lt;br /&gt;
   vt decompose_blocksub -p gatk.vcf -o decomposed_blocksub.vcf &amp;lt;br&amp;gt;&lt;br /&gt;
   #before decomposition&lt;br /&gt;
   #CHROM  POS	    ID	  REF        ALT        QUAL	FILTER	INFO	                                        FORMAT	tumor	     normal&lt;br /&gt;
   1	  159030    .	  TAACCTTTC  TGACCTTTT  0.04	.	AF=0.5	                                        GT      0/0          1/1   &amp;lt;br&amp;gt;                                                               &lt;br /&gt;
   #after decomposition&lt;br /&gt;
   1	  159031    .	  A          G	        0.04	.	AF=0.5;OLD_CLUMPED=1:159030:TAACCTTTC/TGACCTTTT	GT:PS	0|0:159031   1|1:159031&lt;br /&gt;
   1	  159038    .	  C          T	        0.04	.	AF=0.5;OLD_CLUMPED=1:159030:TAACCTTTC/TGACCTTTT	GT:PS	0|0:159031   1|1:159031&lt;br /&gt;
    &lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
   description : decomposes biallelic block substitutions into its constituent SNPs. &amp;lt;br&amp;gt;&lt;br /&gt;
   usage : vt decompose_blocksub [options] &amp;lt;in.vcf&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
   options : -m  keep MNVs (multi-nucleotide variants) [false]&lt;br /&gt;
             -a  enable aggressive/alignment mode [false]&lt;br /&gt;
             -d  MNVs max distance (when -m option is used) [2]&lt;br /&gt;
             -o  output VCF file [-]&lt;br /&gt;
             -I  file containing list of intervals []&lt;br /&gt;
             -i  intervals []&lt;br /&gt;
             -?  displays help-a  enable aggressive/alignment mode&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Decompose===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div&amp;gt;&lt;br /&gt;
Decompose multiallelic variants in a [http://www.1000genomes.org/wiki/analysis/variant-call-format/vcf-variant-call-format-version-42 VCF]  file.   If the VCF file has genotype fields GT,PL, GL or DP, they are&lt;br /&gt;
modified to reflect the change in alleles.  All other genotype fields are removed.  The -s option will retain the fields and decompose fields of counts R and A accordingingly.&lt;br /&gt;
&lt;br /&gt;
Decomposition and combining variants is a complex operation where the correctness is dependent on [[https://github.com/tfarrah tfarrah@github]]:&lt;br /&gt;
&lt;br /&gt;
*whether the observed variants are seen in the same sample,&lt;br /&gt;
*if same sample, whether they are homozygous or heterozygous,&lt;br /&gt;
*if both heterozygous, whether they are in the same haplotype or not (if known). &lt;br /&gt;
&lt;br /&gt;
and one should be aware of the issues in handling variants resulting from such operations. &amp;lt;br&amp;gt; &lt;br /&gt;
The original purpose of this tool is to allow for allelic comparisons between call sets.&lt;br /&gt;
[[https://github.com/atks/vt/issues/16  example of a problem caused in combining separate variant records]]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #decomposes multiallelic variants into biallelic variants and write out to gatk.decomposed.vcf&lt;br /&gt;
   vt decompose gatk.vcf -o gatk.decomposed.vcf &amp;lt;br&amp;gt;&lt;br /&gt;
   #before decomposition&lt;br /&gt;
   #CHROM  POS     ID   REF     ALT         QUAL   FILTER  INFO                  FORMAT    S1                                     S2                                                                          &lt;br /&gt;
   1       3759889 .    TA      TAA,TAAA,T  .      PASS    AF=0.342,0.173,0.037	GT:DP:PL	  1/2:81:281,5,9,58,0,115,338,46,116,809	 0/0:86:0,30,323,31,365,483,38,291,325,567	&amp;lt;br&amp;gt;&lt;br /&gt;
   #after decomposition&lt;br /&gt;
   #CHROM  POS     ID   REF     ALT         QUAL   FILTER  INFO                                        FORMAT   S1               S2             &lt;br /&gt;
   1	  3759889 .    TA      TAA	   .	  PASS    OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T    GT:PL    1/.:281,5,9      0/0:0,30,323	&lt;br /&gt;
   1	  3759889 .    TA      TAAA        .      .       OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T    GT:PL    ./1:281,58,115   0/0:0,31,483	&lt;br /&gt;
   1	  3759889 .    TA      T           .      .       OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T    GT:PL    ./.:281,338,809  0/0:0,38,567	&amp;lt;br&amp;gt;&lt;br /&gt;
   One might want to post process the partial genotypes like 1/. to the best guess genotype based on the PL values.&lt;br /&gt;
&lt;br /&gt;
   #decomposes multiallelic variants into biallelic variants and write out to gatk.decomposed.vcf with the -s option.&lt;br /&gt;
   #-s option splits up INFO and GENOTYPE fields that have number counts of R and A [[https://samtools.github.io/hts-specs/VCFv4.2.pdf VCFv4.2 section 1.2.2]] appropriately.&lt;br /&gt;
   vt decompose -s gatk.vcf -o gatk.decomposed.vcf &amp;lt;br&amp;gt;&lt;br /&gt;
   #before decomposition&lt;br /&gt;
   #CHROM  POS     ID   REF     ALT         QUAL   FILTER  INFO                  FORMAT    S1                                     S2                                                                          &lt;br /&gt;
   1       3759889 .    TA      TAA,TAAA,T  .      PASS    AF=0.342,0.173,0.037	GT:DP:PL	  1/2:81:281,5,9,58,0,115,338,46,116,809	 0/0:86:0,30,323,31,365,483,38,291,325,567	&amp;lt;br&amp;gt;&lt;br /&gt;
   #after decomposition&lt;br /&gt;
   #CHROM  POS     ID   REF     ALT         QUAL   FILTER  INFO                                                 FORMAT   S1               S2           &lt;br /&gt;
   1	  3759889 .    TA      TAA	   .	  PASS    AF=0.342;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T    GT:PL    1/.:281,5,9      0/0:0,30,323	&lt;br /&gt;
   1	  3759889 .    TA      TAAA        .      .       AF=0.173;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T    GT:PL    ./1:281,58,115   0/0:0,31,483	&lt;br /&gt;
   1	  3759889 .    TA      T           .      .       AF=0.037;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T    GT:PL    ./.:281,338,809  0/0:0,38,567	&amp;lt;br&amp;gt;&lt;br /&gt;
   In general, you should recompute fields that involves alleles after decomposition.  Information is generally lost after vertically decomposing a variant, so care should be taken&lt;br /&gt;
   in interpreting the resultant values.  &lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
   description : decomposes multiallelic variants into biallelic in a VCF file. &amp;lt;br&amp;gt;&lt;br /&gt;
   usage : vt decompose [options] &amp;lt;in.vcf&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
   options : -s  smart decomposition [false]&lt;br /&gt;
             -o  output VCF file [-]&lt;br /&gt;
             -I  file containing list of intervals []&lt;br /&gt;
             -i  intervals []&lt;br /&gt;
             -?  displays help&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Drop duplicate variants ===&lt;br /&gt;
&lt;br /&gt;
Drops duplicate variants that appear later in the file.  VCF file must be ordered. &amp;lt;br&amp;gt;&lt;br /&gt;
If there are OLD_VARIANT tags in the INFO field, the variants in these tags are aggregated in the unique record retained.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #drop duplicate variants and save output in mills.uniq.vcf&lt;br /&gt;
   vt uniq mills.vcf -o mills.uniq.vcf&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
   usage : vt uniq [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
   options : -o  output VCF file [-]&lt;br /&gt;
             -I  file containing list of intervals []&lt;br /&gt;
             -i  intervals []&lt;br /&gt;
             -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Paste ===&lt;br /&gt;
&lt;br /&gt;
Pastes VCF files like the unix paste functions.&lt;br /&gt;
&lt;br /&gt;
  Input requirements and assumptions:&lt;br /&gt;
      1. Same variants are represented in the same order for each file (required)&lt;br /&gt;
      2. Genotype field order are the same for corresponding records (required)&lt;br /&gt;
      3. Sample names are different in all the files (warning will be given if not)&lt;br /&gt;
      4. Headers are the same for all the files (assumption, not checked, will fail if output is BCF)&lt;br /&gt;
  Outputs:&lt;br /&gt;
      1. INFO fields output will be that of the first file&lt;br /&gt;
      2. Genotype fields are the same for corresponding records&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #paste together genotypes from the CEU trio into one file.&lt;br /&gt;
   vt paste NA12878.mills.bcf NA12891.mills.bcf NA12892.mills.bcf -o ceu_trio.bcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt paste [options] &amp;lt;in1.vcf&amp;gt;...&lt;br /&gt;
  &lt;br /&gt;
  options : -L  file containing list of input VCF files&lt;br /&gt;
            -o  output VCF file [-]&lt;br /&gt;
            -p  print options and summary []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Concatenate ===&lt;br /&gt;
&lt;br /&gt;
Concatenates VCF files.  Assumes individuals are in the same order and files share the same header.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #concatenates chr1.mills.bcf and chr2.mills.bcf&lt;br /&gt;
   vt cat chr1.mills.bcf chr2.mills.bcf -o mills.bcf&lt;br /&gt;
&lt;br /&gt;
   #concatenates chr1.mills.bcf and chr2.mills.bcf with the naive option.&lt;br /&gt;
   #The naive option assumes that the headers are all the same and skips &lt;br /&gt;
   #merging headers and translating encodings between BCF files.   This is &lt;br /&gt;
   #a much faster option if you know the nature of your BCF files in advance.&lt;br /&gt;
   vt cat -n chr1.mills.bcf chr2.mills.bcf -o mills.bcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt cat [options] &amp;lt;in1.vcf&amp;gt;...&lt;br /&gt;
&lt;br /&gt;
  options : -s  print site information only without genotypes [false]&lt;br /&gt;
            -p  print options and summary [false]&lt;br /&gt;
            -n  naive, assumes that headers are the same. [false]&lt;br /&gt;
            -w  local sorting window size [0]&lt;br /&gt;
            -f  filter expression []&lt;br /&gt;
            -L  file containing list of input VCF files&lt;br /&gt;
            -o  output VCF file [-]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Remove info tags ===&lt;br /&gt;
&lt;br /&gt;
Removes INFO tags from a VCF file&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #removes the INFO tags OLD_VARIANT, ENTROPY, PSCORE and COMP &lt;br /&gt;
   vt rminfo exact.del.bcf -t OLD_VARIANT,ENTROPY,PSCORE,COMP -o rm.bcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt rminfo [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -o  output VCF file [-]&lt;br /&gt;
            -q  do not print options and summary [false]&lt;br /&gt;
            -t  list of info tags to be removed []&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Filter ===&lt;br /&gt;
&lt;br /&gt;
Filters variants in a VCF file&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #adds a filter tag &amp;quot;refA&amp;quot; for variants where the REF column is a A sequence.&lt;br /&gt;
   vt filter in.bcf -f &amp;quot;REF==&#039;A&#039;&amp;quot; -d &amp;quot;refA&amp;quot; &lt;br /&gt;
&lt;br /&gt;
 &amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
   usage : vt filter [options] &amp;lt;in.vcf&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
   options : -x  clear filter [false]&lt;br /&gt;
             -f  filter expression []&lt;br /&gt;
             -d  filter tag description []&lt;br /&gt;
             -t  filter tag []&lt;br /&gt;
             -o  output VCF file [-]&lt;br /&gt;
             -I  file containing list of intervals []&lt;br /&gt;
             -i  intervals&lt;br /&gt;
             -?  displays help &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Filter overlap ===&lt;br /&gt;
&lt;br /&gt;
Tags overlapping variants in a VCF file with the FILTER flag overlap.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #adds a filter tag &amp;quot;overlap&amp;quot; for overlapping variants within a window size of 1 based on the REF sequence.&lt;br /&gt;
   vt filter_overlap in.bcf -w 1 out.bcf&lt;br /&gt;
&lt;br /&gt;
   todo: option for considering END info tag for detecting overlaps.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
   usage : vt filter_overlap [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
   &lt;br /&gt;
   options : -o  output VCF file [-]&lt;br /&gt;
             -w  window overlap for variants [0]&lt;br /&gt;
             -I  file containing list of intervals []&lt;br /&gt;
             -i  intervals []&lt;br /&gt;
             -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Validate ===&lt;br /&gt;
&lt;br /&gt;
Checks the following properties of a VCF file:&lt;br /&gt;
#order&lt;br /&gt;
#reference sequence consistency&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #validates lobstr.bcf&lt;br /&gt;
   vt validate lobstr.bcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt validate [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
  &lt;br /&gt;
  options : -q  do not print invalid records [false]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Extract INFO fields to a tab delimited file ===&lt;br /&gt;
&lt;br /&gt;
Converts a VCF file and its shared information in the INFO field to a tab delimited file for further analysis.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #converts in.bcf to tab format with selected INFO and FILTER fields&lt;br /&gt;
   vt info2tab in.bcf -u PASS -t EX_RL,FZ_RL,MDUST,LOBSTR,VNTRSEEK,RMSK,EX_REPEAT_TRACT&lt;br /&gt;
  &amp;lt;div style=&amp;quot;height:6em; overflow:auto; border: 2px solid #FFF&amp;quot;&amp;gt;&lt;br /&gt;
  INPUT&lt;br /&gt;
  =====&lt;br /&gt;
  20	17548608	.	A	AC	.	PASS	CENTERS=vbi;NCENTERS=1;OLD_MULTIALLELIC=20:17548598:GAAAAAAAAAAAAA/GAAAAAAAAAAAA/GAAAAAAAAAAAAAA/GAAAAAAAAAA/GAAAAAAAAAAA/GAAAAAAAAAACAAA;OLD_VARIANT=20:17548598:GAAAAAAAAAAAAAG/GAAAAAAAAAACAAAG;EX_MOTIF=C;EX_MLEN=1;EX_RU=C;EX_BASIS=C;EX_BLEN=1;EX_REPEAT_TRACT=17548608,17548609;EX_COMP=100,0,0,0;EX_ENTROPY=0;EX_ENTROPY2=0;EX_KL_DIVERGENCE=2;EX_KL_DIVERGENCE2=4;EX_REF=2;EX_RL=2;EX_LL=3;EX_RU_COUNTS=0,2;EX_SCORE=0;EX_TRF_SCORE=-14;FZ_MOTIF=A;FZ_MLEN=1;FZ_RU=A;FZ_BASIS=A;FZ_BLEN=1;FZ_REPEAT_TRACT=17548599,17548611;FZ_COMP=100,0,0,0;FZ_ENTROPY=0;FZ_ENTROPY2=0;FZ_KL_DIVERGENCE=2;FZ_KL_DIVERGENCE2=4;FZ_REF=13;FZ_RL=13;FZ_LL=14;FZ_RU_COUNTS=13,13;FZ_SCORE=1;FZ_TRF_SCORE=26;FLANKSEQ=GAAAAAAAAA[A]AAAGAAGGAA;MDUST;LOBSTR&lt;br /&gt;
  20	17548608	.	AAAAG	A	.	PASS	CENTERS=ox1;NCENTERS=1;EX_MOTIF=AAAG;EX_MLEN=4;EX_RU=AAAG;EX_BASIS=AG;EX_BLEN=2;EX_REPEAT_TRACT=17548609,17548612;EX_COMP=100,0,0,0;EX_ENTROPY=0;EX_ENTROPY2=0;EX_KL_DIVERGENCE=2;EX_KL_DIVERGENCE2=4;EX_REF=0.75;EX_RL=4;EX_LL=4;EX_RU_COUNTS=0,1;EX_SCORE=0.75;EX_TRF_SCORE=-1;FZ_MOTIF=A;FZ_MLEN=1;FZ_RU=A;FZ_BASIS=A;FZ_BLEN=1;FZ_REPEAT_TRACT=17548599,17548611;FZ_COMP=100,0,0,0;FZ_ENTROPY=0;FZ_ENTROPY2=0;FZ_KL_DIVERGENCE=2;FZ_KL_DIVERGENCE2=4;FZ_REF=13;FZ_RL=13;FZ_LL=13;FZ_RU_COUNTS=13,13;FZ_SCORE=1;FZ_TRF_SCORE=26;FLANKSEQ=GAAAAAAAAA[AAAAG]AAGGAACTAC;MDUST;LOBSTR;OLD_VARIANT=20:17548598:GAAAAAAAAAAAAAG/GAAAAAAAAAA&lt;br /&gt;
  &amp;lt;/div&amp;gt;&lt;br /&gt;
  OUTPUT&lt;br /&gt;
  ======&lt;br /&gt;
  CHROM	POS	   REF	  ALT	N_ALLELE  PASS  EX_RL  FZ_RL	MDUST	LOBSTR	VNTRSEEK  RMSK	EX_REPEAT_TRACT_1	EX_REPEAT_TRACT_2&lt;br /&gt;
  20	17548608   A	  AC	2         1     2      13	1	1	0	  0     17548608                17548608&lt;br /&gt;
  20	17548608   AAAAG  A	2         1     4      13       1       1       0         0     17548609                17548609&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt info2tab [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
  &lt;br /&gt;
  options : -d  debug [false]&lt;br /&gt;
            -f  filter expression []&lt;br /&gt;
            -u  list of filter tags to be extracted []-t  list of info tags to be extracted []&lt;br /&gt;
            -o  output tab delimited file [-]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
= VCF Inspection and Evaluation =&lt;br /&gt;
&lt;br /&gt;
=== Peek ===&lt;br /&gt;
&lt;br /&gt;
Summarizes the variants in a VCF file&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #summarizes the variants found in mills.vcf&lt;br /&gt;
   vt peek mills.vcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt peek [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -o  output VCF file [-]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            --  ignores the rest of the labeled arguments following this flag&lt;br /&gt;
            -h  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
For a more detailed guide on [http://genome.sph.umich.edu/wiki/Variant_classification variant classification].&lt;br /&gt;
&lt;br /&gt;
 #This is a sample output of a peek command which summarizes the variants found in a VCF file.&lt;br /&gt;
   stats: no. of samples                     :          0&lt;br /&gt;
          no. of chromosomes                 :         22&amp;lt;br&amp;gt;&lt;br /&gt;
          ========== Micro variants ==========&amp;lt;br&amp;gt;&lt;br /&gt;
          no. of SNPs                        :   77228885&lt;br /&gt;
              2 alleles (ts/tv)              :        77011302 (2.11) [52287790/24723512]&lt;br /&gt;
              3 alleles (ts/tv)              :          216560 (0.75) [185520/247600]&lt;br /&gt;
              4 alleles (ts/tv)              :            1023 (0.50) [1023/2046]&amp;lt;br&amp;gt;&lt;br /&gt;
          no. of MNPs                        :          0&lt;br /&gt;
              2 alleles (ts/tv)              :               0 (-nan) [0/0]&lt;br /&gt;
              &amp;gt;=3 alleles (ts/tv)            :               0 (-nan) [0/0]&amp;lt;br&amp;gt;&lt;br /&gt;
          no. Indels                         :    2147564&lt;br /&gt;
              2 alleles (ins/del)            :         2124842 (0.47) [683250/1441592]&lt;br /&gt;
              &amp;gt;=3 alleles (ins/del)          :           22722 (2.12) [32411/15286]&amp;lt;br&amp;gt;&lt;br /&gt;
          no. SNP/MNP                        :          0&lt;br /&gt;
              3 alleles (ts/tv)              :               0 (-nan) [0/0] &lt;br /&gt;
              &amp;gt;=4 alleles (ts/tv)            :               0 (-nan) [0/0] &amp;lt;br&amp;gt;&lt;br /&gt;
          no. SNP/Indels                     :      12913&lt;br /&gt;
              2 alleles (ts/tv) (ins/del)    :             412 (0.41) [120/292] (3.68) [324/88]&lt;br /&gt;
              &amp;gt;=3 alleles (ts/tv) (ins/del)  :           12501 (0.43) [7670/17649] (18.64) [12434/667]&amp;lt;br&amp;gt;&lt;br /&gt;
          no. MNP/Indels                     :        153&lt;br /&gt;
              2 alleles (ts/tv) (ins/del)    :               0 (-nan) [0/0] (-nan) [0/0]&lt;br /&gt;
              &amp;gt;=3 alleles (ts/tv) (ins/del)  :             153 (0.30) [138/465] (0.27) [67/248]&amp;lt;br&amp;gt;&lt;br /&gt;
          no. SNP/MNP/Indels                 :          2&lt;br /&gt;
              3 alleles (ts/tv) (ins/del)    :               0 (-nan) [0/0] (-nan) [0/0]&lt;br /&gt;
              4 alleles (ts/tv) (ins/del)    :               2 (0.00) [3/5] (1.00) [3/3]&lt;br /&gt;
              &amp;gt;=5 alleles (ts/tv) (ins/del)  :               0 (-nan) [0/0] (-nan) [0/0]&amp;lt;br&amp;gt;&lt;br /&gt;
          no. of clumped variants            :      19025&lt;br /&gt;
              2 alleles                      :               0 (-nan) [0/0] (-nan) [0/0]&lt;br /&gt;
              3 alleles                      :           18508 (0.16) [12152/75366] (0.00) [93/18653]&lt;br /&gt;
              4 alleles                      :             451 (0.15) [369/2390] (0.33) [201/609]&lt;br /&gt;
              &amp;gt;=5 alleles                    :              66 (0.09) [37/414] (1.19) [107/90]&amp;lt;br&amp;gt;&lt;br /&gt;
          ====== Other useful categories =====&amp;lt;br&amp;gt;&lt;br /&gt;
          no. complex variants               :      32093&lt;br /&gt;
              2 alleles (ts/tv) (ins/del)    :             412 (0.41) [120/292] (3.68) [324/88]&lt;br /&gt;
              &amp;gt;=3 alleles (ts/tv) (ins/del)  :           31681 (0.21) [20369/96289] (0.64) [12905/20270]&amp;lt;br&amp;gt;&lt;br /&gt;
          ======= Structural variants ========&amp;lt;br&amp;gt;&lt;br /&gt;
          no. of structural variants         :      41217&lt;br /&gt;
              2 alleles                      :           38079&lt;br /&gt;
                  deletion                   :                13135&lt;br /&gt;
                  insertion                  :                16451&lt;br /&gt;
                     mobile element          :                    16253&lt;br /&gt;
                        ALU                  :                        12513&lt;br /&gt;
                        LINE1                :                         2911&lt;br /&gt;
                        SVA                  :                          829&lt;br /&gt;
                     numt                    :                      198&lt;br /&gt;
                  duplication                :                  664&lt;br /&gt;
                  inversion                  :                  100&lt;br /&gt;
                  copy number variation      :                 7729&lt;br /&gt;
              &amp;gt;=3 alleles                    :            3138&lt;br /&gt;
                  copy number variation      :                 3138 &amp;lt;br&amp;gt;&lt;br /&gt;
          ========= General summary ========== &amp;lt;br&amp;gt;&lt;br /&gt;
          no. of reference                   :          0 &amp;lt;br&amp;gt;&lt;br /&gt;
          no. of observed variants           :   79449759&lt;br /&gt;
          no. of unclassified variants       :          0&lt;br /&gt;
&lt;br /&gt;
=== Partition ===&lt;br /&gt;
&lt;br /&gt;
Partition variants from two data sets.&lt;br /&gt;
&lt;br /&gt;
  &amp;lt;span style=&amp;quot;color:#FF0000&amp;quot;&amp;gt;Please note that this only works if the contigs in the headers of both data sets are the same.&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;   &lt;br /&gt;
   #partitions all variants in bi1.bcf  and bi2.bcf&lt;br /&gt;
   vt partition bi1.bcf bi2.bcf&lt;br /&gt;
&lt;br /&gt;
  Options:     input VCF file a   bi1.bcf&lt;br /&gt;
               input VCF file b   bi2.bcf &amp;lt;br&amp;gt;&lt;br /&gt;
    A:      504676 variants&lt;br /&gt;
    B:     1389333 variants &amp;lt;br&amp;gt;&lt;br /&gt;
                   ts/tv  ins/del&lt;br /&gt;
    A-B      37564 [0.19] [1.34]&lt;br /&gt;
    A&amp;amp;B     467112 [1.55] [0.72]&lt;br /&gt;
    B-A     922221 [1.20] [0.58]&lt;br /&gt;
    of A     92.6%&lt;br /&gt;
    of B     33.6%&lt;br /&gt;
&lt;br /&gt;
   #partitions only passed variants in bi1.bcf and bi2.bcf&lt;br /&gt;
   vt partition bi1.bcf bi2.bcf -f PASS&lt;br /&gt;
&lt;br /&gt;
  Options:     input VCF file a   bi1.bcf&lt;br /&gt;
               input VCF file b   bi2.bcf &lt;br /&gt;
               [f] filter             PASS &amp;lt;br&amp;gt;&lt;br /&gt;
    A:      466148 variants&lt;br /&gt;
    B:      986056 variants &amp;lt;br&amp;gt;&lt;br /&gt;
                   ts/tv  ins/del&lt;br /&gt;
    A-B      47261 [0.44] [1.36]&lt;br /&gt;
    A&amp;amp;B     418887 [1.80] [0.68]&lt;br /&gt;
    B-A     567169 [1.43] [0.72]&lt;br /&gt;
    of A     89.9%&lt;br /&gt;
    of B     42.5%&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
partition v0.5&lt;br /&gt;
&lt;br /&gt;
description : partition variants. check the overlap of variants between 2 data sets.&lt;br /&gt;
&lt;br /&gt;
  usage : vt partition [options] &amp;lt;in1.vcf&amp;gt;&amp;lt;in2.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -w  write partitioned variants to file&lt;br /&gt;
            -f  filter&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
  &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Multi Partition ===&lt;br /&gt;
&lt;br /&gt;
Partitions variants found in VCF files. &amp;lt;br&amp;gt;&lt;br /&gt;
In comparison to the simple 2 way partition, this does not support writing out of partitions to file and &lt;br /&gt;
reporting proportion of shared variants for each VCF.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;   &lt;br /&gt;
   #partitions variants n-ways&lt;br /&gt;
   vt multi_partition hc.genotypes.bcf pl.genotypes.bcf st.genotypes.bcf&lt;br /&gt;
&lt;br /&gt;
  Options:     input VCF file a   hc.genotypes.bcf&lt;br /&gt;
               input VCF file b   pl.genotypes.bcf&lt;br /&gt;
               input VCF file c   st.genotypes.bcf &amp;lt;br&amp;gt;&lt;br /&gt;
      A:       97274 variants&lt;br /&gt;
      B:       95458 variants&lt;br /&gt;
      C:       98943 variants &amp;lt;br&amp;gt;&lt;br /&gt;
                  no  [ts/tv] [ins/del]&lt;br /&gt;
      A--       3887  [1.10]  [0.86]&lt;br /&gt;
      -B-       7890  [1.45]  [0.98]&lt;br /&gt;
      AB-       4360  [0.99]  [1.32]&lt;br /&gt;
      --C       8277  [1.75]  [2.21]&lt;br /&gt;
      A-C       7458  [1.78]  [0.49]&lt;br /&gt;
      -BC       1639  [1.63]  [1.03]&lt;br /&gt;
      ABC      81569  [2.28]  [1.08] &amp;lt;br&amp;gt;&lt;br /&gt;
      Unique variants     :     115080&lt;br /&gt;
      Overall concordance :      70.88% (#intersection/#union)&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  usage : vt multi_partition [options] &amp;lt;in1.vcf&amp;gt;&amp;lt;in2.vcf&amp;gt;...&lt;br /&gt;
  options : -f  filter&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
  &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Annotate Regions ===&lt;br /&gt;
&lt;br /&gt;
Annotates regions in a VCF file.  The BED file should be bgzipped and indexed with tabix.  &lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #annotates the variants that overlap with coding regions.&lt;br /&gt;
   vt annotate_regions mills.vcf -b coding.bed.gz -t CDS -d &amp;quot;Coding region&amp;quot;&lt;br /&gt;
&lt;br /&gt;
   #annotates the variants that overlap with low complexity regions.&lt;br /&gt;
   vt annotate_regions mills.vcf -b mdust.bed.gz -t DUST -d &amp;quot;DUST Low Complexity Region&amp;quot;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  usage : vt annotate_regions [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -d  regions tag description []&lt;br /&gt;
            -t  regions tag []&lt;br /&gt;
            -b  regions BED file []&lt;br /&gt;
            -o  output VCF file [-]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Annotate Variants ===&lt;br /&gt;
&lt;br /&gt;
Annotates variants in a VCF file.  The GENCODE annotation file should be bgzipped and indexed with tabix.  &lt;br /&gt;
This is available in the [[Vt#Resource_Bundle|vt resource bundle]].&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #annotates the variants found in mills.vcf&lt;br /&gt;
   vt annotate_variants mills.vcf -r hs37d5.fa -g gencode.v19.annotation.gtf.gz&lt;br /&gt;
&lt;br /&gt;
  #annotates variants with the following fields&lt;br /&gt;
  ##INFO=&amp;lt;ID=VT,Number=1,Type=String,Description=&amp;quot;Variant Type - SNP, MNP, INDEL, CLUMPED&amp;quot;&amp;gt; &lt;br /&gt;
  ##INFO=&amp;lt;ID=GENCODE_FS,Number=0,Type=Flag,Description=&amp;quot;Frameshift INDEL&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=GENCODE_NFS,Number=0,Type=Flag,Description=&amp;quot;Non Frameshift INDEL&amp;quot;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt annotate_variants [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -g  GENCODE annotations GTF file []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -o  output VCF file [-]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Compute Features ===&lt;br /&gt;
&lt;br /&gt;
Compute features in a VCF file.  Example of statistics are Allele counts, [[Genotype_Likelihood_based_Inbreeding_Coefficient|Genotype Likelihood based Inbreeding Coefficient]].&lt;br /&gt;
[[Genotype_Likelihood_based_Allele_Frequency|Hardy-Weinberg Genotype Likelihood based Allele Frequencies]] &amp;lt;br&amp;gt;&lt;br /&gt;
For more customizable feature computation - look at [http://genome.sph.umich.edu/wiki/Vt#Estimate estimate]&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #compute features for the variants found in vt.vcf&lt;br /&gt;
   #requires GT, PL and DP&lt;br /&gt;
   vt compute_features vt.vcf&lt;br /&gt;
&lt;br /&gt;
  #annotates variants with the following fields&lt;br /&gt;
  ##INFO=&amp;lt;ID=AC,Number=A,Type=Integer,Description=&amp;quot;Alternate Allele Counts&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=AN,Number=1,Type=Integer,Description=&amp;quot;Total Number Allele Counts&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=NS,Number=1,Type=Integer,Description=&amp;quot;Number of Samples With Data&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=AF,Number=A,Type=Float,Description=&amp;quot;Alternate Allele Frequency&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=GC,Number=G,Type=Integer,Description=&amp;quot;Genotype Counts&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=GN,Number=1,Type=Integer,Description=&amp;quot;Total Number of Genotypes Counts&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=GF,Number=G,Type=Float,Description=&amp;quot;Genotype Frequency&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=HWEAF,Number=A,Type=Float,Description=&amp;quot;Genotype likelihood based MLE Allele Frequency assuming HWE&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=HWEGF,Number=G,Type=Float,Description=&amp;quot;Genotype likelihood based MLE Genotype Frequency assuming HWE&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=MLEAF,Number=A,Type=Float,Description=&amp;quot;Genotype likelihood based MLE Allele Frequency&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=MLEGF,Number=G,Type=Float,Description=&amp;quot;Genotype likelihood based MLE Genotype Frequency&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=HWE_LLR,Number=1,Type=Float,Description=&amp;quot;Genotype likelihood based Hardy Weinberg ln(Likelihood Ratio)&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=HWE_LPVAL,Number=1,Type=Float,Description=&amp;quot;Genotype likelihood based Hardy Weinberg Likelihood Ratio Test Statistic ln(p-value)&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=HWE_DF,Number=1,Type=Integer,Description=&amp;quot;Degrees of freedom for Genotype likelihood based Hardy Weinberg Likelihood Ratio Test Statistic&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=FIC,Number=1,Type=Float,Description=&amp;quot;Genotype likelihood based Inbreeding Coefficient&amp;quot;&amp;gt;&lt;br /&gt;
  ##INFO=&amp;lt;ID=AB,Number=1,Type=Float,Description=&amp;quot;Genotype likelihood based Allele Balance&amp;quot;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt compute_features for variants [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
  options : -s  print site information only without genotypes [false]&lt;br /&gt;
            -o  output VCF/VCF.GZ/BCF file [-]&lt;br /&gt;
            -f  filter expression []&lt;br /&gt;
            -I  File containing list of intervals&lt;br /&gt;
            -i  Intervals&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Estimate ===&lt;br /&gt;
&lt;br /&gt;
  Compute variant based estimates.  &lt;br /&gt;
&lt;br /&gt;
  Example of statistics are:&lt;br /&gt;
  * Allele counts&lt;br /&gt;
  * [[Genotype_Likelihood_based_Allele_Frequency|Hardy-Weinberg Genotype Likelihood based Allele Frequencies]]&lt;br /&gt;
  * [[Genotype_Likelihood_based_Inbreeding_Coefficient|Genotype Likelihood based Inbreeding Coefficient]]&lt;br /&gt;
  * [[HWEP|Genotype Likelihood based Hardy-Weinberg test]]&lt;br /&gt;
  * [[Genotype_Likelihood_Based_Allele_Balance|Genotype Likelihood based Allele Balance]]&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #compute features for the variants found in vt.vcf&lt;br /&gt;
   #requires GT and PL&lt;br /&gt;
   vt estimate -e AF,MLEAF vt.vcf&lt;br /&gt;
&lt;br /&gt;
   AF         Genotype (GT) based allele frequencies&lt;br /&gt;
              If genotypes are unavailable, best guess&lt;br /&gt;
              genotypes are inferred based on genotype&lt;br /&gt;
              likelihoods (GL or PL)&lt;br /&gt;
              AC        : Alternate Allele counts&lt;br /&gt;
              AN        : Total allele counts&lt;br /&gt;
              NS        : No. of samples.&lt;br /&gt;
              AF        : Alternate allele frequencies.&lt;br /&gt;
   MLEAF      GL based allele frequencies estimates&lt;br /&gt;
              MLEAF     : Alternate allele frequency derived from MLEGF&lt;br /&gt;
              MLEGF     : Genotype frequencies.&lt;br /&gt;
   HWEAF      GL based allele frequencies estimates assuming HWE&lt;br /&gt;
              HWEAF     : Alternate allele frequencies&lt;br /&gt;
              HWEGF     : Genotype frequencies derived from HWEAF.&lt;br /&gt;
   HWE        GL based Hardy-Weinberg statistics.&lt;br /&gt;
              HWE_LLR   : log likelihood ratio&lt;br /&gt;
              HWE_LPVAL : log p-value&lt;br /&gt;
              HWE_DF    : degrees of freedom&lt;br /&gt;
   AB         GL based Allele Balance.&lt;br /&gt;
   FIC        GL based Inbreeding Coefficient&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt estimate [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
  options : -s  print site information only without genotypes [false]&lt;br /&gt;
            -o  output VCF/VCF.GZ/BCF file [-]&lt;br /&gt;
            -e  comma separated estimates to be computed []&lt;br /&gt;
            -f  filter expression []&lt;br /&gt;
            -I  File containing list of intervals&lt;br /&gt;
            -i  Intervals&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Profile Mendelian Errors ===&lt;br /&gt;
&lt;br /&gt;
Profile Mendelian errors&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #profile mendelian errors found in vt.genotypes.bcf, generate [[media:mendel.pdf|tables]] in the directory mendel, requires pdflatex.&lt;br /&gt;
   vt profile_mendelian vt.genotypes.bcf -p trios.ped -x mendel&lt;br /&gt;
&lt;br /&gt;
   pedigree file format is described in [[Vt#Pedigree File|here]].&lt;br /&gt;
&lt;br /&gt;
   #this is a sample output for mendelian error profiling.&lt;br /&gt;
   #R and A stand for reference and alternate allele respectively.&lt;br /&gt;
   #Error% - mendelian error (confounded with de novo mutation)&lt;br /&gt;
   #HomHet - Homozygous-Heterozygous genotype ratios&lt;br /&gt;
   #Het% - proportion of hets&lt;br /&gt;
   Mendelian Errors &amp;lt;br&amp;gt;&lt;br /&gt;
   Father Mother       R/R          R/A          A/A    Error(%) HomHet    Het(%)&lt;br /&gt;
   R/R    R/R        14889          210           38     1.64       nan    nan&lt;br /&gt;
   R/R    R/A         3403         3497           74     1.06      0.97  50.68&lt;br /&gt;
   R/R    A/A          176         1482          155    18.26       nan    nan&lt;br /&gt;
   R/A    R/R         3665         3652           68     0.92      1.00  49.91&lt;br /&gt;
   R/A    R/A         1015         3151          990     0.00      0.64  61.11&lt;br /&gt;
   R/A    A/A           43         1300         1401     1.57      1.08  48.13&lt;br /&gt;
   A/A    R/R          172         1365          147    18.94       nan    nan&lt;br /&gt;
   A/A    R/A           47         1164         1183     1.96      1.02  49.60&lt;br /&gt;
   A/A    A/A           20           78         5637     1.71       nan    nan &amp;lt;br&amp;gt;&lt;br /&gt;
   Parental            R/R          R/A          A/A    Error(%) HomHet    Het(%)&lt;br /&gt;
   R/R    R/R        14889          210           38     1.64       nan    nan&lt;br /&gt;
   R/R    R/A         7068         7149          142     0.99      0.99  50.28&lt;br /&gt;
   R/R    A/A          348         2847          302    18.59       nan    nan&lt;br /&gt;
   R/A    R/A         1015         3151          990     0.00      0.64  61.11&lt;br /&gt;
   R/A    A/A           90         2464         2584     1.75      1.05  48.81&lt;br /&gt;
   A/A    A/A           20           78         5637     1.71       nan    nan  &amp;lt;br&amp;gt;&lt;br /&gt;
   Parental            R/R          R/A          A/A    Error(%) HomHet    Het(%)&lt;br /&gt;
   HOM    HOM        14909          288         5675     1.66       nan    nan&lt;br /&gt;
   HOM    HET         7158         9613         2726     1.19      1.00  49.90&lt;br /&gt;
   HET    HET         1015         3151          990     0.00      0.64  61.11&lt;br /&gt;
   HOMREF HOMALT       348         2847          302    18.59       nan    nan  &amp;lt;br&amp;gt;&lt;br /&gt;
   total mendelian error :   2.505% &lt;br /&gt;
   no. of trios     : 2&lt;br /&gt;
   no. of variants  : 25346&lt;br /&gt;
  &lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
profile_mendelian v0.5&lt;br /&gt;
&lt;br /&gt;
  usage : vt profile_mendelian [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -q  minimum genotype quality&lt;br /&gt;
            -d  minimum depth&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -x  output latex directory []&lt;br /&gt;
            -p  pedigree file&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals&lt;br /&gt;
           -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Profile SNPs ===&lt;br /&gt;
&lt;br /&gt;
Profile SNPs.  The reference data sets can be obtained from [[Vt#Resource_Bundle|vt resource bundle]].&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #profile snps found in 20.sites.vcf&lt;br /&gt;
   vt profile_snps -g snp.reference.txt 20.sites.vcf -r hs37d5.fa  -i 20&lt;br /&gt;
&lt;br /&gt;
  #this is a sample output for indel profiling.&lt;br /&gt;
  # square brackets contain the ts/tv ratio.  &lt;br /&gt;
  # The numbers in curved bracket are the counts of ts and tv SNPs respectively.&lt;br /&gt;
  # Low complexity shows what percent of the SNPs are in low complexity regions.&lt;br /&gt;
   data set&lt;br /&gt;
     No. SNPs          :     508603 [2.09]&lt;br /&gt;
        Low complexity :       0.08 (39837/508603) &amp;lt;br&amp;gt;&lt;br /&gt;
  1000g&lt;br /&gt;
    A-B     109970 [1.39]&lt;br /&gt;
    A&amp;amp;B     398633 [2.37]&lt;br /&gt;
    B-A    1340682 [2.26]&lt;br /&gt;
    Precision    78.4%&lt;br /&gt;
    Sensitivity  22.9% &amp;lt;br&amp;gt;&lt;br /&gt;
  dbsnp&lt;br /&gt;
    A-B     324063 [1.99]&lt;br /&gt;
    A&amp;amp;B     184540 [2.29]&lt;br /&gt;
    B-A     103893 [2.60]&lt;br /&gt;
    Precision    36.3%&lt;br /&gt;
    Sensitivity  64.0%&lt;br /&gt;
&lt;br /&gt;
  # This file contains information on how to process reference data sets.&lt;br /&gt;
  #&lt;br /&gt;
  # dataset - name of data set, this label will be printed.&lt;br /&gt;
  # type    - True Positives (TP) and False Positives (FP)&lt;br /&gt;
  #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively&lt;br /&gt;
  #         - annotation&lt;br /&gt;
  #           file is used for GENCODE annotation of frame shift and non frame shift Indels&lt;br /&gt;
  # filter  - filter applied to variants for this particular data set &lt;br /&gt;
  # path    - path of indexed BCF file&lt;br /&gt;
  #dataset               type             filter                                 path&lt;br /&gt;
  1000g                  TP               N_ALLELE==2&amp;amp;&amp;amp;VTYPE==SNP                /net/fantasia/home/atks/ref/vt/grch37/1000G.v5.snps.indels.complex.svs.sites.bcf&lt;br /&gt;
  dbsnp                  TP               N_ALLELE==2&amp;amp;&amp;amp;VTYPE==SNP                /net/fantasia/home/atks/ref/vt/grch37/dbSNP138.snps.indels.complex.sites.bcf&lt;br /&gt;
  GENCODE_V19            cds_annotation   .                                      /net/fantasia/home/atks/ref/vt/grch37/gencode.v19.cds.bed.gz&lt;br /&gt;
  DUST                   cplx_annotation  .                                      /net/fantasia/home/atks/ref/vt/grch37/mdust.bed.gz&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt profile_snps [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -f  filter expression []&lt;br /&gt;
            -g  file containing list of reference datasets []&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Profile Indels ===&lt;br /&gt;
&lt;br /&gt;
Profile Indels.  The reference data sets can be obtained from [[Vt#Resource_Bundle|vt resource bundle]].&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #profile indels found in mills.vcf&lt;br /&gt;
   vt profile_indels -g indel.reference.txt mills.vcf -r hs37d5.fa  -i 20&lt;br /&gt;
&lt;br /&gt;
  #this is a sample output for indel profiling.&lt;br /&gt;
  # square brackets contain the ins/del ratio.  &lt;br /&gt;
  # for the FS/NFS field, that is the proportion of coding indels that are frame shifted.  &lt;br /&gt;
  # The numbers in curved bracket are the counts of frame shift and non frame shift indels respectively.&lt;br /&gt;
  data set&lt;br /&gt;
    No Indels :      46974 [0.89]&lt;br /&gt;
       FS/NFS :       0.26 (8/23) &amp;lt;br&amp;gt;&lt;br /&gt;
  dbsnp&lt;br /&gt;
    A-B      30704 [0.92]&lt;br /&gt;
    A&amp;amp;B      16270 [0.83]&lt;br /&gt;
    B-A    2049488 [1.52]&lt;br /&gt;
    Precision    34.6%&lt;br /&gt;
    Sensitivity   0.8% &amp;lt;br&amp;gt;&lt;br /&gt;
  mills&lt;br /&gt;
    A-B      43234 [0.88]&lt;br /&gt;
    A&amp;amp;B       3740 [1.00]&lt;br /&gt;
    B-A     203278 [0.98]&lt;br /&gt;
    Precision     8.0%&lt;br /&gt;
    Sensitivity   1.8% &amp;lt;br&amp;gt;&lt;br /&gt;
  mills.chip&lt;br /&gt;
    A-B      46847 [0.89]&lt;br /&gt;
    A&amp;amp;B        127 [0.90]&lt;br /&gt;
    B-A       8777 [0.93]&lt;br /&gt;
    Precision     0.3%&lt;br /&gt;
    Sensitivity   1.4% &amp;lt;br&amp;gt;&lt;br /&gt;
  affy.exome.chip&lt;br /&gt;
    A-B      46911 [0.89]&lt;br /&gt;
    A&amp;amp;B         63 [0.43]&lt;br /&gt;
    B-A      33997 [0.47]&lt;br /&gt;
    Precision     0.1%&lt;br /&gt;
    Sensitivity   0.2% &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  # This file contains information on how to process reference data sets.&lt;br /&gt;
  # dataset - name of data set, this label will be printed.&lt;br /&gt;
  # type    - True Positives (TP) and False Positives (FP).&lt;br /&gt;
  #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively.&lt;br /&gt;
  #         - annotation.&lt;br /&gt;
  #           file is used for GENCODE annotation of frame shift and non frame shift Indels.&lt;br /&gt;
  # filter  - filter applied to variants for this particular data set.&lt;br /&gt;
  # path    - path of indexed BCF file.&lt;br /&gt;
  #dataset     type            filter                       path&lt;br /&gt;
  1000g        TP              N_ALLELE==2&amp;amp;&amp;amp;VTYPE==INDEL    /net/fantasia/home/atks/ref/vt/grch37/1000G.snps_indels.sites.bcf&lt;br /&gt;
  mills        TP              N_ALLELE==2&amp;amp;&amp;amp;VTYPE==INDEL    /net/fantasia/home/atks/ref/vt/grch37/mills.208620indels.sites.bcf&lt;br /&gt;
  dbsnp        TP              N_ALLELE==2&amp;amp;&amp;amp;VTYPE==INDEL    /net/fantasia/home/atks/ref/vt/grch37/dbsnp.13147541variants.sites.bcf&lt;br /&gt;
  GENCODE_V19  cds_annotation  .                            /net/fantasia/home/atks/ref/vt/grch37/gencode.cds.bed.gz&lt;br /&gt;
  DUST         cplx_annotation .                            /net/fantasia/home/atks/ref/vt/grch37/mdust.bed.gz&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt profile_indels [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -g  file containing list of reference datasets []&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Profile VNTRs ===&lt;br /&gt;
&lt;br /&gt;
Profile VNTRs.  The reference data sets can be obtained from [[Vt#Resource_Bundle|vt resource bundle]].&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  #profiles a set of VNTRs&lt;br /&gt;
  vt profile_vntrs vntrs.sites.bcf -g vntr.reference.txt &lt;br /&gt;
  &lt;br /&gt;
&lt;br /&gt;
  profile_vntrs v0.5&lt;br /&gt;
  &lt;br /&gt;
    no VNTRs           5660874           #number of VNTRs in vntrs.sites.bcf&lt;br /&gt;
    no low complexity  2686460 (47.46%)  #number of VNTRs in low complexity region determined by MDUST&lt;br /&gt;
    no coding          17911 (0.32%)     #number of VNTRs in coding regions determined by GENCODE v7&lt;br /&gt;
    no redundant       1312209 (23.18%)  #number of VNTRs involved in overlapping with one another&amp;lt;br&amp;gt;&lt;br /&gt;
  trf_lobstr (1638516)  #TRF based reference set used in lobSTR, motif lengths 1 to 6.&lt;br /&gt;
    A-B     3269285     #TRs specific to vntrs.sites.bcf&lt;br /&gt;
    A-B~    1666185     #TRs in vntrs.sites.bcf that overlap partially with at least one TR in TRF(lobSTR) but does not overlap exactly with another TR.&lt;br /&gt;
    A&amp;amp;B1     725404     #TRs in vntrs.sites.bcf that overlap exactly with at least one TR in TRF(lobSTR)&lt;br /&gt;
    A&amp;amp;B2     723195     #TRs in TRF(lobSTR) that overlap exactly with at least one TR in vntrs.sites.bcf&lt;br /&gt;
    B-A~     710075     #TRs in TRF(lobSTR) that overlap partially with at least one TR in vntrs.sites.bcf but does not overlap exactly with another TR.&lt;br /&gt;
    B-A      205246     #TRs specific to TRF(lobSTR)&lt;br /&gt;
  #note that the first 3 rows should sum up to the number of TRs in vntrs.sites.bcf&lt;br /&gt;
  #and the 4th to 6th rows should sum up to the number of TRs in TRF( lobSTR) &lt;br /&gt;
  #This basically allows us to see the m to n overlapping in overlapping TRs&amp;lt;br&amp;gt;&lt;br /&gt;
  trf_repeatseq (1624553) #TRF based reference set used in repeatseq, motif lengths 1 to 6.&lt;br /&gt;
    A-B     3291652 &lt;br /&gt;
    A-B~    1650190 &lt;br /&gt;
    A&amp;amp;B1     719032 &lt;br /&gt;
    A&amp;amp;B2     716838 &lt;br /&gt;
    B-A~     703948 &lt;br /&gt;
    B-A      203767  &amp;lt;br&amp;gt;&lt;br /&gt;
  trf_vntrseek (230306)   #TRF based reference set used in vntrseek, motif lengths 7 to 2000.&lt;br /&gt;
    A-B     5384453 &lt;br /&gt;
    A-B~     271302 &lt;br /&gt;
    A&amp;amp;B1       5119 &lt;br /&gt;
    A&amp;amp;B2       4973 &lt;br /&gt;
    B-A~      92496 &lt;br /&gt;
    B-A      132837  &amp;lt;br&amp;gt;&lt;br /&gt;
  codis+ (15)             #CODIS STRs + 2 STRs from PROMEGA&lt;br /&gt;
    A-B     5660794 &lt;br /&gt;
    A-B~         79 &lt;br /&gt;
    A&amp;amp;B1          1 &lt;br /&gt;
    A&amp;amp;B2          1 &lt;br /&gt;
    B-A~         14 &lt;br /&gt;
    B-A           0 &lt;br /&gt;
&lt;br /&gt;
  # This file contains information on how to process reference data sets.&lt;br /&gt;
  # dataset - name of data set, this label will be printed.&lt;br /&gt;
  # type    - True Positives (TP) and False Positives (FP).&lt;br /&gt;
  #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively.&lt;br /&gt;
  #         - annotation.&lt;br /&gt;
  #           file is used for GENCODE annotation of coding VNTRs.&lt;br /&gt;
  # filter  - filter applied to variants for this particular data set.&lt;br /&gt;
  # path    - path of indexed BCF file.&lt;br /&gt;
  #dataset      type            filter                       path&lt;br /&gt;
  trf_lobstr    TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.lobstr.sites.bcf&lt;br /&gt;
  trf_repeatseq TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.repeatseq.sites.bcf&lt;br /&gt;
  trf_vntrseek  TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.vntrseek.sites.bcf&lt;br /&gt;
  codis+        TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/codis.strs.sites.bcf&lt;br /&gt;
  GENCODE_V19   cds_annotation  .                            /net/fantasia/home/atks/ref/vt/grch37/gencode.v19.cds.bed.gz&lt;br /&gt;
  DUST          cplx_annotation .                              &lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt profile_vntrs [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -g  file containing list of reference datasets []&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Profile NA12878 ===&lt;br /&gt;
&lt;br /&gt;
Profile Mendelian errors&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #profile NA12878 overlap with broad knowledgebase and illumina platinum genomes for the file vt.genotypes.bcf for chromosome 20.&lt;br /&gt;
   vt profile_na12878  vt.genotypes.bcf -g na12878.reference.txt -r hs37d5.fa -i 20 &lt;br /&gt;
&lt;br /&gt;
   #this is a sample output for mendelian error profiling.&lt;br /&gt;
   #R and A stand for reference and alternate allele respectively.&lt;br /&gt;
   #Error% - mendelian error (confounded with de novo mutation)&lt;br /&gt;
   #HomHet - Homozygous-Heterozygous genotype ratios&lt;br /&gt;
   #Het% - proportion of hets&lt;br /&gt;
     data set&lt;br /&gt;
    No Indels :      27770 [0.94]&lt;br /&gt;
       FS/NFS :       0.26 (8/23) &amp;lt;br&amp;gt;&lt;br /&gt;
  broad.kb&lt;br /&gt;
    A-B      13071 [1.19]&lt;br /&gt;
    A&amp;amp;B      14699 [0.76]&lt;br /&gt;
    B-A      21546 [0.62]&lt;br /&gt;
    Precision    52.9%&lt;br /&gt;
    Sensitivity  40.6% &amp;lt;br&amp;gt;&lt;br /&gt;
  illumina.platinum&lt;br /&gt;
    A-B      17952 [0.88]&lt;br /&gt;
    A&amp;amp;B       9818 [1.07]&lt;br /&gt;
    B-A       2418 [0.88]&lt;br /&gt;
    Precision    35.4%&lt;br /&gt;
    Sensitivity  80.2% &amp;lt;br&amp;gt;&lt;br /&gt;
  broad.kb&lt;br /&gt;
                R/R       R/A       A/A       ./.&lt;br /&gt;
    R/R         346       145         3      5473&lt;br /&gt;
    R/A           3      4133         9       758&lt;br /&gt;
    A/A           2       136      2186       956&lt;br /&gt;
    ./.           2       139        86       322 &amp;lt;br&amp;gt;&lt;br /&gt;
    Total genotype pairs :      6963&lt;br /&gt;
    Concordance          :  95.72% (6665)&lt;br /&gt;
    Discordance          :   4.28% (298) &amp;lt;br&amp;gt;&lt;br /&gt;
  illumina.platinum&lt;br /&gt;
                R/R       R/A       A/A       ./.&lt;br /&gt;
    R/R        1768        85         2         0&lt;br /&gt;
    R/A          10      4479        14         0&lt;br /&gt;
    A/A          13       180      3028         0&lt;br /&gt;
    ./.          71        98        70         0&amp;lt;br&amp;gt;&lt;br /&gt;
    Total genotype pairs :      9579&lt;br /&gt;
    Concordance          :  96.83% (9275)&lt;br /&gt;
    Discordance          :   3.17% (304)&lt;br /&gt;
&lt;br /&gt;
   # This file contains information on how to process reference data sets.&lt;br /&gt;
   #&lt;br /&gt;
   # dataset - name of data set, this label will be printed.&lt;br /&gt;
   # type    - True Positives (TP) and False Positives (FP)&lt;br /&gt;
   #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively&lt;br /&gt;
   #         - annotation&lt;br /&gt;
   #           file is used for GENCODE annotation of frame shift and non frame shift Indels&lt;br /&gt;
   # filter  - filter applied to variants for this particular data set&lt;br /&gt;
   # path    - path of indexed BCF file&lt;br /&gt;
   #dataset              type         filter    path&lt;br /&gt;
   broad.kb              TP           PASS      /net/fantasia/home/atks/dev/vt/bundle/public/grch37/broad.kb.241365variants.genotypes.bcf&lt;br /&gt;
   illumina.platinum     TP           PASS      /net/fantasia/home/atks/dev/vt/bundle/public/grch37/NA12878.illumina.platinum.5284448variants.genotypes.bcf&lt;br /&gt;
   #gencode.v19           annotation   .         /net/fantasia/home/atks/dev/vt/bundle/public/grch37/gencode.v19.annotation.gtf.gz&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
profile_na12878 v0.5&lt;br /&gt;
&lt;br /&gt;
  usage : vt profile_na12878 [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -g  file containing list of reference datasets []&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
= Variant Calling =&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== Discover ===&lt;br /&gt;
&lt;br /&gt;
Discovers variants from reads in a BAM/CRAM file.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #discover variants from NA12878.bam and write to stdout&lt;br /&gt;
   vt discover -b NA12878.bam -s NA12878 -r hs37d5.fa -i 20 &lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt discover2 [options] &lt;br /&gt;
&lt;br /&gt;
  options : -b  input BAM/CRAM file&lt;br /&gt;
          -y  soft clipped unique sequences cutoff [0]&lt;br /&gt;
          -x  soft clipped mean quality cutoff [0]&lt;br /&gt;
          -w  insertion desired type II error [0.0]&lt;br /&gt;
          -c  insertion desired type I error [0.0]&lt;br /&gt;
          -h  insertion fractional evidence cutoff [0]&lt;br /&gt;
          -g  insertion count cutoff [1]&lt;br /&gt;
          -n  deletion desired type II error [0.0]&lt;br /&gt;
          -m  deletion desired type I error [0.0]&lt;br /&gt;
          -v  deletion fractional evidence cutoff [0]&lt;br /&gt;
          -u  deletion count cutoff [1]&lt;br /&gt;
          -k  snp desired type II error [0.0]&lt;br /&gt;
          -j  snp desired type I error [0.0]&lt;br /&gt;
          -f  snp fractional evidence cutoff [0]&lt;br /&gt;
          -e  snp evidence count cutoff [1]&lt;br /&gt;
          -q  base quality cutoff for bases [0]&lt;br /&gt;
          -C  likelihood ratio cutoff [0]&lt;br /&gt;
          -B  reference bias [0]&lt;br /&gt;
          -a  read exclude flag [0x0704]&lt;br /&gt;
          -l  ignore overlapping reads [false]&lt;br /&gt;
          -t  MAPQ cutoff for alignments [0]&lt;br /&gt;
          -p  ploidy [2]&lt;br /&gt;
          -s  sample ID&lt;br /&gt;
          -r  reference sequence fasta file []&lt;br /&gt;
          -o  output VCF file [-]&lt;br /&gt;
          -z  ignore MD tags [0]&lt;br /&gt;
          -d  debug [0]&lt;br /&gt;
          -I  file containing list of intervals []&lt;br /&gt;
          -i  intervals []&lt;br /&gt;
          -?  displays help&lt;br /&gt;
&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Merge candidate variants ===&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Merge candidate variants across samples.  Each VCF file is required to have the FORMAT flags E and N and should have exactly one sample.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #merge candidate variants from VCFs in candidate.txt and output in candidate.sites.vcf&lt;br /&gt;
   vt merge_candidate_variants candidates.txt -o candidate.sites.vcf&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt merge_candidate_variants [options] &lt;br /&gt;
&lt;br /&gt;
  options : -L  file containing list of input VCF files&lt;br /&gt;
            -o  output VCF file [-]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals&lt;br /&gt;
            --  ignores the rest of the labeled arguments following this flag&lt;br /&gt;
            -h  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Filter overlap ===&lt;br /&gt;
&lt;br /&gt;
Removes overlapping variants in a VCF file by tagging such variants with the FILTER flag overlap.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #annotates variants that are overlapping  &lt;br /&gt;
   vt filter_overlap in.vcf -r hs37d5.fa -o overlapped.tagged..vcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt filter_overlap [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -o  output VCF file [-]&lt;br /&gt;
            -w  window overlap for variants [0]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #Use Remove overlap instead for versions older than Jan 12, 2017&lt;br /&gt;
   vt remove_overlap in.vcf -r hs37d5.fa -o overlapped.tagged..vcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
    usage: vt remove_overlap [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
    The old version has the same options except that it lacks the -w option&lt;br /&gt;
    The change occurred in the following commit:&lt;br /&gt;
    https://github.com/atks/vt/commit/ab5cf7e91b3baa5349f439e6fe92491ae19da1a6&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Annotate Indels ===&lt;br /&gt;
&lt;br /&gt;
Annotates indels with VNTR information and adds a VNTR record.  Facilitates the simultaneous calling of VNTR together with Indels and SNPs.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #annotates indels from VCFs with VNTR information.&lt;br /&gt;
   vt annotate_indels in.vcf -r hs37d5.fa -o annotated.sites.vcf&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div style=&amp;quot;height:20em; overflow:auto; border: 2px solid #FFF&amp;quot;&amp;gt;&lt;br /&gt;
  CHROM   POS     ID      REF     ALT     QUAL    FILTER  INFO&lt;br /&gt;
  20      82079   .       G       A       1255.98 .       NSAMPLES=1;E=43;N=51;ESUM=43;NSUM=51;FLANKSEQ=GGAGCACGCC[G/A]CCATGCCCGG&lt;br /&gt;
  20      82217   .       G       A       1632.77 .       NSAMPLES=1;E=56;N=61;ESUM=56;NSUM=61;FLANKSEQ=GAGCCACCGC[G/A]CCCGGCCCAG&lt;br /&gt;
  20      83250   .       CTGTGTGTG       C       .       .       NSAMPLES=1;E=18;N=35;ESUM=18;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:&amp;lt;VNTR&amp;gt;:GT&lt;br /&gt;
  20      83250   .       CTGTGTGTGTG     C       .       .       NSAMPLES=1;E=3;N=35;ESUM=3;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:&amp;lt;VNTR&amp;gt;:GT&lt;br /&gt;
  20      83251   .       TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG    &amp;lt;VNTR&amp;gt;  .       .       MOTIF=GT;RU=TG;FZ_CONCORDANCE=1;FZ_RL=52;FZ_LL=0;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FZ_RU_COUNTS=26,26;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG]TTTAGTATTT&lt;br /&gt;
  20      83252   .       G       C       359.204 .       NSAMPLES=1;E=13;N=14;ESUM=13;NSUM=14;FLANKSEQ=CTCTCTCTCT[G/C]TGTGTGTGTG&lt;br /&gt;
  20      83260   .       G       C       500.163 .       NSAMPLES=1;E=18;N=34;ESUM=18;NSUM=34;FLANKSEQ=CTGTGTGTGT[G/C]TGTGTGTGTG&lt;br /&gt;
  20      83267   .       T       C       247.043 .       NSAMPLES=1;E=11;N=43;ESUM=11;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT&lt;br /&gt;
  20      83275   .       T       C       609.669 .       NSAMPLES=1;E=24;N=43;ESUM=24;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT&lt;br /&gt;
  20      90008   .       C       A       1546.88 .       NSAMPLES=1;E=52;N=60;ESUM=52;NSUM=60;FLANKSEQ=AACAGAAAAC[C/A]AAATACTGTA&lt;br /&gt;
  20      91088   .       C       T       1766.04 .       NSAMPLES=1;E=58;N=66;ESUM=58;NSUM=66;FLANKSEQ=CCCAGCATAC[C/T]ATGGTTGTGC&lt;br /&gt;
  20      91508   .       G       A       1266.93 .       NSAMPLES=1;E=44;N=53;ESUM=44;NSUM=53;FLANKSEQ=AATTAGTAAG[G/A]CTTACGTAAG&lt;br /&gt;
  20      91707   .       C       T       888.134 .       NSAMPLES=1;E=30;N=53;ESUM=30;NSUM=53;FLANKSEQ=TGATTTTCTA[C/T]AGCAGGACCT&lt;br /&gt;
  20      92527   .       A       G       828.593 .       NSAMPLES=1;E=34;N=40;ESUM=34;NSUM=40;FLANKSEQ=ATTAATTGCC[A/G]TTCTCTCTTT&lt;br /&gt;
  20      93440   .       A       G       688.144 .       NSAMPLES=1;E=24;N=58;ESUM=24;NSUM=58;FLANKSEQ=TTGGATGCAT[A/G]GTCTGTAAAT&lt;br /&gt;
  20      93636   .       TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT     &amp;lt;VNTR&amp;gt;  .       .       MOTIF=T;RU=T;FZ_CONCORDANCE=0.939394;FZ_RL=35;FZ_LL=0;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FZ_RU_COUNTS=31,33;FLANKSEQ=TCTAGGATTC[TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT&lt;br /&gt;
  20      93646   .       C       CT      .       .       NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FLANKSEQ=TTTTTCTTTC[TTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT;GMOTIF=T;TR=20:93636:TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT:&amp;lt;VNTR&amp;gt;:T&lt;br /&gt;
  20      93717   .       A       T       31.7622 .       NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKSEQ=CAGTGGCGTG[A/T]TCTTAGATCA&lt;br /&gt;
  20      93931   .       G       A       628.149 .       NSAMPLES=1;E=22;N=53;ESUM=22;NSUM=53;FLANKSEQ=GATTACAGGT[G/A]TGAGCCGCTG&lt;br /&gt;
  20      100699  .       C       T       809.09  .       NSAMPLES=1;E=28;N=61;ESUM=28;NSUM=61;FLANKSEQ=GGTGAAAAAT[C/T]ACCTGTCAGT&lt;br /&gt;
  20      101362  .       G       A       1087.13 .       NSAMPLES=1;E=36;N=67;ESUM=36;NSUM=67;FLANKSEQ=TAATACTGAA[G/A]TTTACTTCTC&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  The following shows the trace of how the algorithm works&lt;br /&gt;
&lt;br /&gt;
    ============================================&lt;br /&gt;
    ANNOTATING INDEL FUZZILY&lt;br /&gt;
    ********************************************&lt;br /&gt;
    EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT&lt;br /&gt;
    &lt;br /&gt;
    20:131948:C/CCA&lt;br /&gt;
    EXACT REGION 131948-131965 (18) &lt;br /&gt;
                 CCACACACACACACACAA&lt;br /&gt;
    FINAL EXACT REGION 131948-131965 (18) &lt;br /&gt;
                       CCACACACACACACACAA&lt;br /&gt;
    ********************************************&lt;br /&gt;
    PICK CANDIDATE MOTIFS&lt;br /&gt;
    &lt;br /&gt;
    Longest Allele : C[CA]CACACACACACACACAA&lt;br /&gt;
    detecting motifs for an str&lt;br /&gt;
    seq: CCACACACACACACACACAA&lt;br /&gt;
    len : 20&lt;br /&gt;
    cmax_len : 10&lt;br /&gt;
    candidate motifs: 25&lt;br /&gt;
    AC : 0.894737 2 0&lt;br /&gt;
    AAC : 0.5 3 0.0555556&lt;br /&gt;
    ACC : 0.5 3 0.0555556&lt;br /&gt;
    AAAC : 0.0588235 4 0.125 (&amp;lt; 2 copies)&lt;br /&gt;
    ACCC : 0.0588235 4 0.125 (&amp;lt; 2 copies)&lt;br /&gt;
    AACAC : 0.5 5 0.02&lt;br /&gt;
    ACACC : 0.5 5 0.02&lt;br /&gt;
    AAACAC : 0.0666667 6 0.0555556 (&amp;lt; 2 copies)&lt;br /&gt;
    ACACCC : 0.0666667 6 0.0555556 (&amp;lt; 2 copies)&lt;br /&gt;
    AACACAC : 0.5 7 0.0102041&lt;br /&gt;
    ACACACC : 0.5 7 0.0102041&lt;br /&gt;
    AAACACAC : 0.0769231 8 0.03125 (&amp;lt; 2 copies)&lt;br /&gt;
    ACACACCC : 0.0769231 8 0.03125 (&amp;lt; 2 copies)&lt;br /&gt;
    AACACACAC : 0.5 9 0.00617284 (&amp;lt; 2 copies)&lt;br /&gt;
    ACACACACC : 0.5 9 0.00617284 (&amp;lt; 2 copies)&lt;br /&gt;
    AAACACACAC : 0.0909091 10 0.02 (&amp;lt; 2 copies)&lt;br /&gt;
    ACACACACCC : 0.0909091 10 0.02 (&amp;lt; 2 copies)&lt;br /&gt;
    ********************************************&lt;br /&gt;
    PICKING NEXT BEST MOTIF&lt;br /&gt;
    &lt;br /&gt;
    selected:         AC 0.89 0.00&lt;br /&gt;
    ********************************************&lt;br /&gt;
    DETECTING REPEAT TRACT FUZZILY&lt;br /&gt;
    ++++++++++++++++++++++++++++++++++++++++++++&lt;br /&gt;
    Exact left/right alignment&lt;br /&gt;
    &lt;br /&gt;
    repeat_tract              : CACACACACACACACA&lt;br /&gt;
    position                  : [131949,131964]&lt;br /&gt;
    motif_concordance         : 1&lt;br /&gt;
    repeat units              : 8&lt;br /&gt;
    exact repeat units        : 8&lt;br /&gt;
    total no. of repeat units : 8&lt;br /&gt;
    &lt;br /&gt;
    ++++++++++++++++++++++++++++++++++++++++++++&lt;br /&gt;
    Fuzzy right alignment&lt;br /&gt;
    &lt;br /&gt;
    repeat motif : CA&lt;br /&gt;
    rflank       : AACTC&lt;br /&gt;
    mlen         : 2&lt;br /&gt;
    rflen        : 5&lt;br /&gt;
    plen         : 111&lt;br /&gt;
    &lt;br /&gt;
    read         : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC&lt;br /&gt;
    rlen         : 106&lt;br /&gt;
    &lt;br /&gt;
    optimal score: 50.5073&lt;br /&gt;
    optimal state: MR&lt;br /&gt;
    optimal track: MR|r|0|5&lt;br /&gt;
    optimal probe len: 25&lt;br /&gt;
    optimal path length : 107&lt;br /&gt;
    max j: 106&lt;br /&gt;
    probe: (1~82) [1~10] (1~5)&lt;br /&gt;
    read : (1~82) [83~101] (102~106)&lt;br /&gt;
    &lt;br /&gt;
    motif #           : 10 [83,101]&lt;br /&gt;
    motif concordance : 95% (9/10)&lt;br /&gt;
    motif discordance : 0|1|0|0|0|0|0|0|0|0&lt;br /&gt;
    &lt;br /&gt;
    Model:  ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC &lt;br /&gt;
           SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME&lt;br /&gt;
                                                                                              oo++oo++oo++oo++oo++RRRRR &lt;br /&gt;
    Read:   AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC &lt;br /&gt;
    &lt;br /&gt;
    ++++++++++++++++++++++++++++++++++++++++++++&lt;br /&gt;
    Fuzzy left alignment&lt;br /&gt;
    &lt;br /&gt;
    lflank       : ATCTTA&lt;br /&gt;
    repeat motif : CA&lt;br /&gt;
    lflen        : 6&lt;br /&gt;
    mlen         : 2&lt;br /&gt;
    plen         : 111&lt;br /&gt;
    &lt;br /&gt;
    read         : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT&lt;br /&gt;
    rlen         : 105&lt;br /&gt;
    &lt;br /&gt;
    optimal score: 50.5858&lt;br /&gt;
    optimal state: Z&lt;br /&gt;
    optimal track: Z|m|10|2&lt;br /&gt;
    optimal probe len: 26&lt;br /&gt;
    optimal path length : 106&lt;br /&gt;
    max j: 105&lt;br /&gt;
    mismatch penalty: 3&lt;br /&gt;
    &lt;br /&gt;
    model: (1~6) [1~10]&lt;br /&gt;
    read : (1~6) [7~25][26~106]&lt;br /&gt;
    &lt;br /&gt;
    motif #           : 10 [7,25]&lt;br /&gt;
    motif concordance : 95% (9/10)&lt;br /&gt;
    motif discordance : 0|1|0|0|0|0|0|0|0|0&lt;br /&gt;
    &lt;br /&gt;
    Model:  ATCTTACACACACACACACACACACA-------------------------------------------------------------------------------- &lt;br /&gt;
           SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE&lt;br /&gt;
            LLLLLLoo++oo++oo++oo++oo++                                                                                 &lt;br /&gt;
    Read:   ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT &lt;br /&gt;
    &lt;br /&gt;
    xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx&lt;br /&gt;
    VNTR Summary&lt;br /&gt;
    rid          : 19&lt;br /&gt;
    motif        : AC&lt;br /&gt;
    ru           : CA&lt;br /&gt;
    &lt;br /&gt;
    Exact&lt;br /&gt;
    repeat_tract                    : CACACACACACACACA&lt;br /&gt;
    position                        : [131949,131964]&lt;br /&gt;
    reference repeat unit length    : 8&lt;br /&gt;
    motif_concordance               : 1&lt;br /&gt;
    repeat units                    : 8&lt;br /&gt;
    exact repeat units              : 8&lt;br /&gt;
    total no. of repeat units       : 8&lt;br /&gt;
    &lt;br /&gt;
    Fuzzy&lt;br /&gt;
    repeat_tract                    : CACCACACACACACACACA&lt;br /&gt;
    position                        : [131946,131964]&lt;br /&gt;
    reference repeat unit length    : 19&lt;br /&gt;
    motif_concordance               : 0.95&lt;br /&gt;
    repeat units                    : 19&lt;br /&gt;
    exact repeat units              : 9&lt;br /&gt;
    total no. of repeat units       : 10&lt;br /&gt;
    xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt annotate_indels [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -v  add vntr record [false]&lt;br /&gt;
            -x  override tags [false]&lt;br /&gt;
            -f  filter expression []&lt;br /&gt;
            -d  debug [false]&lt;br /&gt;
            -m  mode [f]&lt;br /&gt;
                e : by exact alignment              f : by fuzzy alignment&lt;br /&gt;
            -c  classification schemas of tandem repeat [6]&lt;br /&gt;
                1 : lai2003     &lt;br /&gt;
                2 : kelkar2008  &lt;br /&gt;
                3 : fondon2012  &lt;br /&gt;
                4 : ananda2013  &lt;br /&gt;
                5 : willems2014 &lt;br /&gt;
                6 : tan_kang2015&lt;br /&gt;
            -a  annotation type [v]&lt;br /&gt;
                v : a. output VNTR variant (defined by classification).&lt;br /&gt;
                       RU                    repeat unit on reference sequence (CA)&lt;br /&gt;
                       MOTIF                 canonical representation (AC)&lt;br /&gt;
                       RL                    repeat tract length in bases (11)&lt;br /&gt;
                       FLANKS                flanking positions of repeat tract determined by exact alignment&lt;br /&gt;
                       RU_COUNTS             number of exact repeat units and total number of repeat units in&lt;br /&gt;
                                             repeat tract determined by exact alignment&lt;br /&gt;
                       FZ_RL                 fuzzy repeat tract length in bases (11)&lt;br /&gt;
                       FZ_FLANKS             flanking positions of repeat tract determined by fuzzy alignment&lt;br /&gt;
                       FZ_RU_COUNTS          number of exact repeat units and total number of repeat units in&lt;br /&gt;
                                             repeat tract determined by fuzzy alignment&lt;br /&gt;
                       FLANKSEQ              flanking sequence of indel&lt;br /&gt;
                       LARGE_REPEAT_REGION   repeat region exceeding 2000bp&lt;br /&gt;
                    b. mark indels with overlapping VNTR.&lt;br /&gt;
                       FLANKS       flanking positions of repeat tract determined by exact alignment&lt;br /&gt;
                       FZ_FLANKS    flanking positions of repeat tract determined by fuzzy alignment&lt;br /&gt;
                       GMOTIF       generating motif used in fuzzy alignment&lt;br /&gt;
                       TR    position and alleles of VNTR (20:23413:CACACACACAC:&amp;lt;VNTR&amp;gt;)&lt;br /&gt;
                a : annotate each indel with RU, RL, MOTIF, REF.&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -o  output VCF file [-]&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals&lt;br /&gt;
            -?  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Construct Probes ===&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Construct probes for genotyping a variant.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #construct probes from candidate.sites.bcf and output to standard out&lt;br /&gt;
   vt construct_probes candidates.sites.bcf -r ref.fa&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt construct_probes [options] &amp;lt;in.vcf&amp;gt;&lt;br /&gt;
&lt;br /&gt;
  options : -o  output VCF file [-]&lt;br /&gt;
            -f  minimum flank length [20]&lt;br /&gt;
            -r  reference sequence fasta file []&lt;br /&gt;
            -I  file containing list of intervals []&lt;br /&gt;
            -i  intervals []&lt;br /&gt;
            --  ignores the rest of the labeled arguments following this flag&lt;br /&gt;
            -h  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== Genotype ===&lt;br /&gt;
&lt;br /&gt;
Genotypes variants for each sample.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot; mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
   #genotypes variants found in candidate.sites.vcf from sample.bam&lt;br /&gt;
   vt genotype -r seq.fa -b sample.bam -i candidates.sites.vcf -o sample.sites.vcf&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
  usage : vt genotype [options] &lt;br /&gt;
&lt;br /&gt;
  options : -r  reference sequence fasta file []&lt;br /&gt;
            -s  sample ID []&lt;br /&gt;
            -o  output VCF file [-]&lt;br /&gt;
            -b  input BAM file []&lt;br /&gt;
            -i  input candidate VCF file []&lt;br /&gt;
            --  ignores the rest of the labeled arguments following this flag&lt;br /&gt;
            -h  displays help&lt;br /&gt;
 &amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
= Pedigree File =&lt;br /&gt;
&lt;br /&gt;
   vt understands an augmented version introduced by [mailto:hmkang@umich.edu Hyun] of the PED described by [http://zzz.bwh.harvard.edu/plink/data.shtml#ped plink].&lt;br /&gt;
   The pedigree file format is as follows with the following mandatory fields:&lt;br /&gt;
         &lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! scope=&amp;quot;col&amp;quot;| Field&lt;br /&gt;
! scope=&amp;quot;col&amp;quot;| Description&lt;br /&gt;
! scope=&amp;quot;col&amp;quot;| Valid Values&lt;br /&gt;
! scope=&amp;quot;col&amp;quot;| Missing Values&lt;br /&gt;
|-&lt;br /&gt;
|Family ID&amp;lt;br&amp;gt;&lt;br /&gt;
Individual ID&amp;lt;br&amp;gt;&lt;br /&gt;
Paternal ID&amp;lt;br&amp;gt;&lt;br /&gt;
Maternal ID&amp;lt;br&amp;gt;&lt;br /&gt;
Sex&amp;lt;br&amp;gt;&lt;br /&gt;
Phenotype&lt;br /&gt;
|ID of this family &amp;lt;br&amp;gt;&lt;br /&gt;
ID(s) of this individual (comma separated) &amp;lt;br&amp;gt;&lt;br /&gt;
ID of the father &amp;lt;br&amp;gt;&lt;br /&gt;
ID of the mother &amp;lt;br&amp;gt;&lt;br /&gt;
Sex of the individual&amp;lt;br&amp;gt;&lt;br /&gt;
Phenotype &lt;br /&gt;
|[A-Za-z0-9_]+&amp;lt;br&amp;gt;&lt;br /&gt;
[A-Za-z0-9_]+(,[A-Za-z0-9_]+)* &amp;lt;br&amp;gt;&lt;br /&gt;
[A-Za-z0-9_]+ &amp;lt;br&amp;gt;&lt;br /&gt;
[A-Za-z0-9_]+&amp;lt;br&amp;gt;&lt;br /&gt;
1=male, 2=female, other, male, female&amp;lt;br&amp;gt;&lt;br /&gt;
[A-Za-z0-9_]+&lt;br /&gt;
|  0 &amp;lt;br&amp;gt;&lt;br /&gt;
cannot be missing &amp;lt;br&amp;gt;&lt;br /&gt;
0 &amp;lt;br&amp;gt;&lt;br /&gt;
0 &amp;lt;br&amp;gt;&lt;br /&gt;
other&amp;lt;br&amp;gt;&lt;br /&gt;
-9&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
  Examples:     &lt;br /&gt;
&lt;br /&gt;
     ceu      NA12878    NA12891     NA12892     female    -9&lt;br /&gt;
     yri      NA19240    NA19239     NA19238     female    -9&lt;br /&gt;
&lt;br /&gt;
     ceu      NA12878    NA12891     NA12892     2     -9&lt;br /&gt;
     yri      NA19240    NA19239     NA19238     2     -9&lt;br /&gt;
&lt;br /&gt;
     #allows tools like profile_mendelian to detect duplicates and check for concordance&lt;br /&gt;
     ceu      NA12878,NA12878A    NA12891     NA12892     female   case&lt;br /&gt;
     yri      NA19240             NA19239     NA19238     female   control&lt;br /&gt;
&lt;br /&gt;
     #allows tools like profile_mendelian to detect duplicates and check for concordance&lt;br /&gt;
     ceu      NA12412    0  0     female  case&lt;br /&gt;
     yri      NA19650    0  0     female  control&lt;br /&gt;
&lt;br /&gt;
= Resource Bundle =&lt;br /&gt;
&lt;br /&gt;
== GRCh37 ==&lt;br /&gt;
&lt;br /&gt;
Files are based on hs37d5.fa made by Heng Li.&lt;br /&gt;
&lt;br /&gt;
* External : [ftp://share.sph.umich.edu/vt/grch37 GRCh37 resource bundle]&lt;br /&gt;
* Internal : /net/fantasia/home/atks/ref/vt/grch37&lt;br /&gt;
&lt;br /&gt;
Read here for [ftp://share.sph.umich.edu/vt/grch37/readme.txt contents].&lt;br /&gt;
&lt;br /&gt;
== GRCh38 ==&lt;br /&gt;
&lt;br /&gt;
Files are based on [https://github.com/lh3/bwa/blob/master/README-alt.md hs38DH.fa] made by Heng Li.&lt;br /&gt;
Note that many of the references are simply lifted over from GRCh37 using Picard&#039;s liftover tool with the default options.&lt;br /&gt;
&lt;br /&gt;
* External : [ftp://share.sph.umich.edu/vt/grch38 GRCh38 resource bundle]&lt;br /&gt;
* Internal : /net/fantasia/home/atks/ref/vt/grch38&lt;br /&gt;
&lt;br /&gt;
Read here for [ftp://share.sph.umich.edu/vt/grch38/readme.txt contents].&lt;br /&gt;
&lt;br /&gt;
= FAQ =&lt;br /&gt;
&lt;br /&gt;
==1. vt cannot retrieve sequences from my reference sequence file ==&lt;br /&gt;
&lt;br /&gt;
  It is common to use reference files based on the UCSC browser&#039;s database and from the Genome Reference Consortium.&lt;br /&gt;
  For example, HG19 vs Grch37.  The key difference is that chromosome 1 is represented as chr1 and 1 respectively in the &lt;br /&gt;
  FASTA files from these 2 sources.  Just use the appropriate FASTA file that was used to generate your VCF file originally.&lt;br /&gt;
&lt;br /&gt;
  Another common issue is due to the corruption of the index file of the reference sequence; say for a reference file named&lt;br /&gt;
  hs37d5.fa or hs37d5.fa.gz, simply delete the index file denoted by hs37d5.fa.fai or hs37d5.fa.gz.fai and run the vt command &lt;br /&gt;
  again.  A new index file will be generated automatically.&lt;br /&gt;
&lt;br /&gt;
= How to cite vt? =&lt;br /&gt;
&lt;br /&gt;
If you use normalize: &amp;lt;br&amp;gt;&lt;br /&gt;
[http://bioinformatics.oxfordjournals.org/content/31/13/2202 Adrian Tan, Gonçalo R. Abecasis and Hyun Min Kang. Unified Representation of Genetic Variants. Bioinformatics (2015) 31(13): 2202-2204]&lt;br /&gt;
&lt;br /&gt;
= Maintained by =&lt;br /&gt;
&lt;br /&gt;
This page is maintained by  [mailto:atks@umich.edu Adrian]&lt;/div&gt;</summary>
		<author><name>Ttbek</name></author>
	</entry>
</feed>