View source for FASTA

A simple text format for storing DNA sequences.

A FASTA file can store one or more DNA sequences. Each record in a FASTA file begins with a &gt; character (which must be the first character in the line) a sequence label and optional commentary. This record is followed by a sequence that can wrap over multiple lines, as needed. Typically, each line has about 50 characters and it is recommended that every line in a sequence should have the same length -- to facilitate indexing.

== Example ==

  >sequenceName Comments about the sequence len=120
  ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC
  ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC
  ACTGACTGACACTGACTGAC