FASTA - Revision history

Goncalo at 23:39, 23 March 2010

2010-03-23T23:39:15Z

← Older revision		Revision as of 19:39, 23 March 2010
Line 1:		Line 1:
	A simple text format for storing DNA sequences.		A simple text format for storing DNA sequences.

	A FASTA file can store one or more DNA sequences. Each record in a FASTA file begins with a > character (which must be the first character in the line) a sequence label and optional commentary. This ~~record~~ is followed by a sequence that can wrap over multiple lines, as needed. Typically, each line has about 50 characters and it is recommended that every line in a sequence should have the same length -- to facilitate indexing.		A FASTA file can store one or more DNA sequences. Each record in a FASTA file begins with one line header a > character (which must be the first character in the line), a sequence label and optional commentary. This header line is followed by a sequence that can wrap over multiple lines, as needed. Typically, each line has about 50 characters and it is recommended that every line in a sequence should have the same length -- to facilitate indexing. Nearly all programs that support FASTA format recognize A, C, T, G and N as valid characters in the sequence. Many also recognize IUPAC codes.

	== Example ==		== Example ==

Goncalo: /* Example */

2010-03-23T23:37:35Z

Example

← Older revision		Revision as of 19:37, 23 March 2010
Line 5:		Line 5:
	== Example ==		== Example ==

	>sequenceName Comments about the sequence len = 120		>sequenceName Comments about the sequence len=120
	ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC		ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC
	ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC		ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC
	ACTGACTGACACTGACTGAC		ACTGACTGACACTGACTGAC

Goncalo: Created page with 'A simple text format for storing DNA sequences. A FASTA file can store one or more DNA sequences. Each record in a FASTA file begins with a > character (which must be the fir…'

2010-03-23T23:37:23Z

Created page with 'A simple text format for storing DNA sequences. A FASTA file can store one or more DNA sequences. Each record in a FASTA file begins with a > character (which must be the fir…'

New page

A simple text format for storing DNA sequences.

A FASTA file can store one or more DNA sequences. Each record in a FASTA file begins with a > character (which must be the first character in the line) a sequence label and optional commentary. This record is followed by a sequence that can wrap over multiple lines, as needed. Typically, each line has about 50 characters and it is recommended that every line in a sequence should have the same length -- to facilitate indexing.

== Example ==

>sequenceName Comments about the sequence len = 120
ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC
ACTGACTGACACTGACTGACACTGACTGACACTGACTGACACTGACTGAC
ACTGACTGACACTGACTGAC