Goncalo: Created page with 'This stuff was originally included in the main page, but seems pretty specific to our local uses, so I have moved it here, to the talk page. Probably even better to go into our i…'

2010-09-09T03:20:37Z

Created page with 'This stuff was originally included in the main page, but seems pretty specific to our local uses, so I have moved it here, to the talk page. Probably even better to go into our i…'

New page

This stuff was originally included in the main page, but seems pretty specific to our local uses, so I have moved it here, to the talk page. Probably even better to go into our internal wiki.

== Available Test Datasets ==

*Location: wonderland:~zhanxw/BigSimulation
*Scenarios:

no polymorphism ; 1, 2, 3 SNP ; Deletion 5, 30, 200; Insertion 5, 30

*Quality String

Picked the 75 percentile of Sanger Iluumina 108 mer test data set
BCCCCBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBAAAAAAAAAA@@@@@@@@@@@@@@@???????????>>>>>>>>>>>>=========<<<<<<<<<<;;";

*Format

Both base space and color space

Both single end and paired end, and paired end reads are given insert size 1500.

Forward strand and reverse strand are randomly assign with probability 1/2

* Tag

@2:12345:F:SE:Exact

@2:12345:F:SE:SNP:2,12345,A,G;2,12346,T,C

@2:12345:F:PE+offset:SNP:2,12345,A,G (ref is A, read is G)

@2:12345:F:PE+offset:Indel:25M30D5M

* File Naming

BS_SE_EXACT_1M_50

BS_SE_SNP1_1M_50

CS_SE_INDEL1_1M

CS_SE_INDEL30_1M

CS_SE_INDEL200_1M

CS_SE_DEL1_1M

For PE, appending "_1" and "_2", e.g.:

PE_EXACT_1M_1

PE_EXACT_1M_2

*Program (generator)

Usage:

generator [bs|cs] [se|pe] [exact|snpXX|indelXX|delXX] -n numbers -l readLength -i insertSize
exact: Accurate sample from reference genome
snpXX: Bring total XXX SNP for a single read or a pair of reads
indelXX: Insert a random XX-length piece for a single read, or at the same position for a paired reads
delXX: Delete a random XX-length piece for a single read, or at the same position for a paired reads
e.g. ./generator bs se exact -n 100 -l 35

*Output

Simulation file are named like: BS_SE_EXACT_1000000_35, meaning base space, single end, exact (no polymorphism), 1M reads, 35 bp per read. For each read, the tag was named in a similar way to Sanger's.

* Example

For illumina (from Sanger, 108mer hap1 test file):

Example:
<pre>
_1 file:
@20:14812275:F:217;None;None/1
AGTTGTTTACTTTCCTTTCCTACCTGGCTGCATCTGTCACATGCATATAGTGTCCCCTGACATGAAGCTCTGATATTGATCTGGAGCCCTATTGGTCTGCAAGTGACT
+
%27::2:::<70<<::95<<6/8<.)3;::9-,3:6/67731/.+)66;;53'31;9<815.%%%+%4-%%%90-)./26<831))(.%%%%%%%)%0%2%%%%%+%%

@15:59364621:R:-118;None;None/1
TGTTCAACCCACTATTAAGCCAGTATTAAATTGTTAATATCAGTTATTATACTTTTATTTCTAAAATTTCTATTTGATCCCTTTTTTTATAAACTCCAATGCATTCTC
+
%%2=;28>>>>=><>>>>>=>>=>>>;>=>9<1%+,//0+)<<91<4=;;<.%)2::8;;/9<;;;;8647<<;8;;066:<:4628;;;;5:9<<0/25752:3482

_2 file:
@20:14812275:F:217;None;None/2
CACTGGAGGGAATCCAATCCCAAATTAATATAACAAAACCAGAAGCTTGCTTAAAAAATATTTTATCAGATTCCAAAGTTGAGCTTGTGTTAGGGTGTACTGGAACTC
+
%%0;+250::-863486::599<9679/2%%))%+80%--7<;9/1%33,-%%)28/),3,67-8;56<1%)0/%%8;<;59/%%,())%%1%%+%).%099'4;+%-

@15:59364621:R:-118;None;None/2
AGAAATAAGACCACATGACAATGTTAAAAATAAAACAGGCAATAGCAATAGTCCCAGAGGTGGTTACAATATGATTTCATGCTCCAGAAAGTATAGGAGAAGACAAAG
+
%3===;==;7<<;7<5;==<<4<;9=8==<====:<<<<<;<==:=<58;===;:8'8:<===:.9:38908:=;;7;57)%.+%)967%%-%%'6:-%)7);<;0+%
</pre>

Conclusion:

If the first read is forward, then itself is the same as reference sequence and the second read is reverse complement to the reference sequence.

If the first read is backward, then itself is reverse complement to the reference genome and the second read is the same as the reference sequence.

The first strand always position can always obtain from tag, first two fields (seperated by colon).

The second strand position is first strand position plus the offset.

For SOLiD (from Sanger, 50 mer hap1 test file)
e.g.

<pre>
_1 file:
>2:67043752:F:1445;2,67043761,A,G;None
T12221203021201200302123102221322000012301300211213
22212031230012003021211022213220000123013022112123 (ref)
>4:125830377:R:-1541;None;None
T30002222300330113020203010322111010300030003230320

_2 file:
>2:67043752:F:1445;2,67043761,A,G;None
G13031223023023012201210020003310110111111203310211
30312230230230122012100200033121201111113033112112 (ref)

>4:125830377:R:-1541;None;None
G13311131230200010201210032223330120312000301230032

</pre>

Conclusion:
The first strand and second strand have the same direction (both either same as the reference genome, or reverse complement to reference genome),
where their positions are the same as Illumina reads.

<br>

= Bulk statistics result =
Running time (all submitted to the MOSIX client nodes)
<br>
Calculated by "./parseRunbatch.py batch2.log |cutrange 0,-1|charrange :-1".

Log file is from runbatch.pl and negative time means unfinished (at the moment of editing).

TODO: Add file size comparison; add link to memory page summarized by Dharknes.
<pre>
BWA(second) Karma(second) Scenarios
7561 4638 BS_PE_DEL200_1000000_50_?.fastq
7548 4677 BS_PE_DEL30_1000000_50_?.fastq
7225 4730 BS_PE_DEL5_1000000_50_?.fastq
975 6531 BS_PE_EXACT_1000000_50_?.fastq
1726 793 BS_PE_INDEL30_1000000_50_?.fastq
6199 4140 BS_PE_INDEL5_1000000_50_?.fastq
1193 4949 BS_PE_SNP1_1000000_50_?.fastq
1646 4513 BS_PE_SNP2_1000000_50_?.fastq
2064 4089 BS_PE_SNP3_1000000_50_?.fastq
2594 3707 BS_SE_DEL200_1000000_50.fastq
2641 3942 BS_SE_DEL30_1000000_50.fastq
2355 4263 BS_SE_DEL5_1000000_50.fastq
441 4228 BS_SE_EXACT_1000000_50.fastq
809 764 BS_SE_INDEL30_1000000_50.fastq
2217 3932 BS_SE_INDEL5_1000000_50.fastq
645 3808 BS_SE_SNP1_1000000_50.fastq
1102 3473 BS_SE_SNP2_1000000_50.fastq
1142 3267 BS_SE_SNP3_1000000_50.fastq
6193 6909 CS_PE_DEL200_1000000_50_?.fastq
6173 6636 CS_PE_DEL30_1000000_50_?.fastq
6096 6702 CS_PE_DEL5_1000000_50_?.fastq
858 8496 CS_PE_EXACT_1000000_50_?.fastq
1743 948 CS_PE_INDEL30_1000000_50_?.fastq
5517 5412 CS_PE_INDEL5_1000000_50_?.fastq
1253 8454 CS_PE_SNP1_1000000_50_?.fastq
2113 7420 CS_PE_SNP2_1000000_50_?.fastq
2622 6076 CS_PE_SNP3_1000000_50_?.fastq
3878 1493 CS_SE_DEL200_1000000_50.fastq
3859 1513 CS_SE_DEL30_1000000_50.fastq
3775 1542 CS_SE_DEL5_1000000_50.fastq
621 1666 CS_SE_EXACT_1000000_50.fastq
1392 289 CS_SE_INDEL30_1000000_50.fastq
3525 1390 CS_SE_INDEL5_1000000_50.fastq
874 1661 CS_SE_SNP1_1000000_50.fastq
1965 1449 CS_SE_SNP2_1000000_50.fastq
3314 1237 CS_SE_SNP3_1000000_50.fastq
</pre>

Talk:Evaluating a Read Mapper on Simulated Data - Revision history

Goncalo: Created page with 'This stuff was originally included in the main page, but seems pretty specific to our local uses, so I have moved it here, to the talk page. Probably even better to go into our i…'