Variant classification: Difference between revisions
| (38 intermediate revisions by the same user not shown) | |||
| Line 3: | Line 3: | ||
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences. | The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences. | ||
On this wiki page, we describe a a variant classification system for VCF | On this wiki page, we describe a a variant classification system for VCF entries that is invariant to [http://genome.sph.umich.edu/wiki/Variant_Normalization normalization] except for the case of MNPs. | ||
= Definitions = | = Definitions = | ||
The definition of a variant is based on the definition of each allele with respect to the reference sequence. We consider 5 major types loosely | The definition of a variant is based on the definition of each allele with respect to the reference sequence. We consider 5 major types loosely decribed as follows. | ||
;1. SNP | ;1. SNP | ||
: The reference and alternate sequences are of length 1 and the base nucleotide is different from one another. | : The reference and alternate sequences are of length 1 and the base nucleotide is different from one another. | ||
;2. MNP | ;2. MNP | ||
: | : The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another. | ||
: OR | : OR | ||
: | : All reference and alternate sequences have the same length (this is applicable to all alleles). | ||
;3. INDEL | ;3. INDEL | ||
: | : The reference and alternate sequences are not of the same length. | ||
;4. CLUMPED | ;4. CLUMPED | ||
: | : A clumping of nearby SNPs, MNPs or Indels. | ||
;5. SV | ;5. SV | ||
: The alternate sequence is represented by | : The alternate sequence is represented by an angled bracket tag. | ||
= Classification Procedure = | = Classification Procedure = | ||
#Trim each allele with respect to the reference sequence individually | |||
#Inspect length, defined as length of alternate allele minus length of reference allele. | |||
##if length = 0 | |||
###if length(ref) = 1 and nucleotides differ, classify as SNP (count ts and tv too) | |||
###if length(ref) > 1 | |||
####if all nucleotides differ, classify as MNP (count ts and tv too) | |||
####if not all nucleotides differ, classify as CLUMPED (count ts and tv too) | |||
##if length <math>\ne</math> 0, classify as INDEL | |||
###if shorter allele is of length 1 | |||
####if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification | |||
###if shorter allele length > 1 | |||
####compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too) | |||
#####if all nucleotides differ, add MNP classification | |||
#####if not all nucleotides differ, add CLUMPED classification | |||
#Variant classification is the union of the classifications of each allele present in the variant. | |||
#If all alleles are the same length, add MNP classification. | |||
= Examples = | = Examples = | ||
We present the following examples to explain the | We present the following examples to explain the classification described. | ||
== Legend for examples == | == Legend for examples == | ||
| Line 52: | Line 60: | ||
MNP<br> | MNP<br> | ||
REF AT | REF AT | ||
ALT GC # | ALT GC #MNP, 2 ts | ||
INDEL<br> | INDEL<br> | ||
| Line 61: | Line 69: | ||
REF AT | REF AT | ||
ALT T #INDEL, 1 del | ALT T #INDEL, 1 del | ||
#Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base. | |||
#If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles. | |||
#Simple Indel classification should be invariant whether it is left or right aligned. | |||
SV<br> | SV<br> | ||
| Line 71: | Line 82: | ||
REF AT | REF AT | ||
ALT G #SNP, INDEL, 1 ts | ALT G #SNP, INDEL, 1 ts | ||
#Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually | |||
#not defined. In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which | |||
#is a transversion. In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition | |||
#and transversion contribution. But please be very clear that this is an ambiguous case. It is better to consider this simply | |||
#as a complex variant. | |||
MNP|INDEL<br> | MNP|INDEL<br> | ||
| Line 78: | Line 94: | ||
MNP|CLUMPED<br> | MNP|CLUMPED<br> | ||
REF ATTTT | REF ATTTT | ||
ALT GTTTC #MNP, | ALT GTTTC #MNP, CLUMPED, 2 ts | ||
#since all the alleles are of the same length, classified as MNP too. | |||
INDEL|CLUMPED<br> | INDEL|CLUMPED<br> | ||
| Line 108: | Line 124: | ||
ALT GT #SNP, 1 ts | ALT GT #SNP, 1 ts | ||
ALT AC #SNP, 1 ts | ALT AC #SNP, 1 ts | ||
#since all the alleles are of the sample length, classified as MNP too. | |||
SNP|MNP|CLUMPED<br> | SNP|MNP|CLUMPED<br> | ||
REF ATTTG | REF ATTTG | ||
ALT GTTTC #CLUMPED, 1 ts, 1 tv | ALT GTTTC #CLUMPED, 1 ts, 1 tv | ||
ALT ATTTC #SNP, 1 tv | ALT ATTTC #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP | ||
#since all the alleles are of the sample length, classified as MNP too. | |||
SNP|MNP|INDEL<br> | SNP|MNP|INDEL<br> | ||
| Line 127: | Line 143: | ||
ALT AG #MNP, INDEL, 1 ts, 1 tv | ALT AG #MNP, INDEL, 1 ts, 1 tv | ||
ALT GTGTG #SNP, INDEL, CLUMPED, 1 tv, 1 ins | ALT GTGTG #SNP, INDEL, CLUMPED, 1 tv, 1 ins | ||
== Structured Variants Examples == | == Structured Variants Examples == | ||
| Line 134: | Line 148: | ||
SV<br> | SV<br> | ||
REF G | REF G | ||
ALT <INS:ME:LINE1> | ALT <INS:ME:LINE1> #SV | ||
SV<br> | SV<br> | ||
REF G | REF G | ||
ALT <CN4> | ALT <CN4> #SV | ||
ALT <CN12> | ALT <CN12> #SV | ||
=Interesting Variant Types = | |||
Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. <br> | |||
20 9538655 <span style="color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> <STR> | |||
This can be induced as | |||
one record considering only the ATTT repeats | |||
20 9538655 <span style="color:#FF0000">ATTTATTTATTT </span> <span style="color:#FF0000">ATTT </span> | |||
one record with CATT repeats | |||
20 9538695 <span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span> | |||
one record with a mix of both repeat types | |||
20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span> | |||
= Representation of close by variants = | |||
1:124001690 | |||
TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG | |||
TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG | |||
a single complex variant | |||
CHROM POS REF ALT | |||
1 124001690 C AAA | |||
an Indel and SNP adjacent to one another | |||
CHROM POS REF ALT | |||
1 124001689 T TAA | |||
1 124001690 C A | |||
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together. | |||
Representing it as 2 separate variants allows both alleles to segregate independently. | |||
= Output = | = Output = | ||
| Line 157: | Line 207: | ||
3 alleles : 273 (0.89) [537/601] | 3 alleles : 273 (0.89) [537/601] | ||
4 alleles : 3 (1.00) [9/9] <br> | 4 alleles : 3 (1.00) [9/9] <br> | ||
no. of Indel : 6600770 | no. of Indel : 6600770 #also referred to as simple Indels | ||
2 alleles : 6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts | 2 alleles : 6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts | ||
3 alleles : 280892 (8.72) [503977/57807] | 3 alleles : 280892 (8.72) [503977/57807] | ||
| Line 211: | Line 261: | ||
4 alleles : 34 (1.16) [109/94] | 4 alleles : 34 (1.16) [109/94] | ||
>=5 alleles : 4 (0.76) [13/17] <br> | >=5 alleles : 4 (0.76) [13/17] <br> | ||
no. of Complex Substitutions : 159298 #equivalent to categories not including | no. of Complex Substitutions : 159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels | ||
2 alleles : 81508 (0.61) [60312/98113] (0.66) [32479/49029] | 2 alleles : 81508 (0.61) [60312/98113] (0.66) [32479/49029] | ||
3 alleles : 71003 (0.69) [35811/51840] (0.34) [34268/100942] | 3 alleles : 71003 (0.69) [35811/51840] (0.34) [34268/100942] | ||
Latest revision as of 21:44, 25 February 2016
Introduction
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.
On this wiki page, we describe a a variant classification system for VCF entries that is invariant to normalization except for the case of MNPs.
Definitions
The definition of a variant is based on the definition of each allele with respect to the reference sequence. We consider 5 major types loosely decribed as follows.
- 1. SNP
- The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
- 2. MNP
- The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
- OR
- All reference and alternate sequences have the same length (this is applicable to all alleles).
- 3. INDEL
- The reference and alternate sequences are not of the same length.
- 4. CLUMPED
- A clumping of nearby SNPs, MNPs or Indels.
- 5. SV
- The alternate sequence is represented by an angled bracket tag.
Classification Procedure
- Trim each allele with respect to the reference sequence individually
- Inspect length, defined as length of alternate allele minus length of reference allele.
- if length = 0
- if length(ref) = 1 and nucleotides differ, classify as SNP (count ts and tv too)
- if length(ref) > 1
- if all nucleotides differ, classify as MNP (count ts and tv too)
- if not all nucleotides differ, classify as CLUMPED (count ts and tv too)
- if length 0, classify as INDEL
- if shorter allele is of length 1
- if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification
- if shorter allele length > 1
- compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)
- if all nucleotides differ, add MNP classification
- if not all nucleotides differ, add CLUMPED classification
- compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)
- if shorter allele is of length 1
- if length = 0
- Variant classification is the union of the classifications of each allele present in the variant.
- If all alleles are the same length, add MNP classification.
Examples
We present the following examples to explain the classification described.
Legend for examples
<variant classification>
REF <reference sequence> ALT <alternative sequence 1> #<allele classification>, <contribution to transition, transversion, insertion or deletion count> ALT <alternative sequence 2> #<allele classification>, <contribution to transition, transversion, insertion or deletion count>
Simple Biallelic Examples
SNP
REF A ALT G #SNP, 1 ts
MNP
REF AT ALT GC #MNP, 2 ts
INDEL
REF AT ALT A #INDEL, 1 del
INDEL
REF AT ALT T #INDEL, 1 del #Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base. #If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles. #Simple Indel classification should be invariant whether it is left or right aligned.
SV
REF A ALT <DEL> #SV
Complex Biallelic Examples
SNP|INDEL
REF AT ALT G #SNP, INDEL, 1 ts #Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually #not defined. In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which #is a transversion. In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition #and transversion contribution. But please be very clear that this is an ambiguous case. It is better to consider this simply #as a complex variant.
MNP|INDEL
REF ATT ALT GG #MNP, INDEL, 1 ts, 1 tv, 1 del
MNP|CLUMPED
REF ATTTT ALT GTTTC #MNP, CLUMPED, 2 ts #since all the alleles are of the same length, classified as MNP too.
INDEL|CLUMPED
REF ATTTTTTTT ALT GTTTC #INDEL, CLUMPED, 2 ts, 1 del
Simple Multiallelic Examples
SNP
REF A ALT G #SNP, 1 ts ALT C #SNP, 1 tv
MNP
REF AG ALT GC #MNP, 1 ts, 1 tv ALT CT #MNP, 2 tv
INDEL
REF ATTT ALT ATT #INDEL, 1 del ALT ATTTT #INDEL, 1 ins
Complex Multiallelic Examples
SNP|MNP
REF AT ALT GT #SNP, 1 ts ALT AC #SNP, 1 ts #since all the alleles are of the sample length, classified as MNP too.
SNP|MNP|CLUMPED
REF ATTTG ALT GTTTC #CLUMPED, 1 ts, 1 tv ALT ATTTC #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP #since all the alleles are of the sample length, classified as MNP too.
SNP|MNP|INDEL
REF GT ALT CT #SNP, 1 tv ALT AG #MNP, 2 tv ALT GTT #INDEL, 1 ins
SNP|MNP|INDEL|CLUMPED
REF GTTT ALT CG #MNP, INDEL, 2 tv, 1 del ALT AG #MNP, INDEL, 1 ts, 1 tv ALT GTGTG #SNP, INDEL, CLUMPED, 1 tv, 1 ins
Structured Variants Examples
SV
REF G ALT <INS:ME:LINE1> #SV SV
REF G ALT <CN4> #SV ALT <CN12> #SV
Interesting Variant Types
Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel.
20 9538655 ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTCATTCATTCATTCATTCATTCATTC <STR>
This can be induced as one record considering only the ATTT repeats 20 9538655 ATTTATTTATTT ATTT
one record with CATT repeats 20 9538695 CATTCATT CATT
one record with a mix of both repeat types
20 9538695 TATTCATTCATT CATT
Representation of close by variants
1:124001690
TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG
TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
a single complex variant
CHROM POS REF ALT
1 124001690 C AAA
an Indel and SNP adjacent to one another
CHROM POS REF ALT
1 124001689 T TAA
1 124001690 C A
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together. Representing it as 2 separate variants allows both alleles to segregate independently.
Output
This is the annotated output of peek in the vt suite.
stats:no. of samples : 0 #number of genotype fields in VCF file, this is a site list so it is 0
no. of chromosomes : 25 #no. of chromosomes observed in this file.
========== Micro variants ==========
no. of SNP : 54247827 #total number of SNPs
2 alleles : 53487808 (1.99) [35616038/17871770] #ts/tv ratio and the respective counts
3 alleles : 389190 (0.60) [291224/487156]
4 alleles : 370828 (0.50) [370828/741656]
>=5 alleles : 1 (0.33) [1/3]
no. of MNP : 122125
2 alleles : 121849 (1.56) [152383/97816]
3 alleles : 273 (0.89) [537/601]
4 alleles : 3 (1.00) [9/9]
no. of Indel : 6600770 #also referred to as simple Indels
2 alleles : 6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts
3 alleles : 280892 (8.72) [503977/57807]
4 alleles : 28245 (131.19) [84094/641]
>=5 alleles : 5772 (3847.00) [23082/6]
no. of SNP/MNP : 1161
3 alleles : 1143 (1.57) [1565/994]
4 alleles : 15 (1.36) [34/25]
>=5 alleles : 3 (0.67) [8/12]
no. of SNP/Indel : 115153
2 alleles : 42717 (0.65) [16778/25939] (0.57) [15441/27276] #ts/tv and ins/del ratios
3 alleles : 66401 (0.72) [29681/41397] (0.33) [31458/96168]
4 alleles : 4631 (0.55) [2420/4386] (0.25) [2602/10306]
>=5 alleles : 1404 (0.62) [1197/1926] (0.10) [513/4989]
no. of MNP/Indel : 15619
2 alleles : 12820 (0.51) [12099/23648] (0.77) [5594/7226]
3 alleles : 2455 (0.40) [1796/4469] (0.45) [1144/2546]
4 alleles : 292 (0.24) [215/891] (1.42) [415/292]
>=5 alleles : 52 (0.43) [96/225] (2.47) [126/51]
no. of SNP/MNP/Indel : 273
3 alleles : 167 (0.63) [201/321] (0.38) [70/184]
4 alleles : 85 (0.35) [71/203] (0.28) [31/111]
>=5 alleles : 21 (0.35) [24/68] (0.68) [25/37]
no. of MNP/Clumped : 61175
2 alleles : 60617 (1.68) [84410/50220]
3 alleles : 549 (1.23) [1777/1449]
4 alleles : 8 (1.43) [53/37]
>=5 alleles : 1 (1.00) [5/5]
no. of SNP/MNP/Clumped : 290
3 alleles : 282 (1.35) [665/494]
4 alleles : 8 (0.57) [13/23]
no. of Indel/Clumped : 27638
2 alleles : 25971 (0.65) [31435/48526] (0.79) [11444/14527]
3 alleles : 1585 (0.74) [3568/4793] (0.87) [1383/1582]
4 alleles : 70 (0.55) [96/175] (1.61) [124/77]
>=5 alleles : 12 (0.59) [37/63] (4.71) [33/7]
no. of SNP/Indel/Clumped : 456
3 alleles : 257 (0.84) [332/394] (0.33) [111/340]
4 alleles : 174 (0.38) [105/279] (0.58) [186/321]
>=5 alleles : 25 (0.19) [12/63] (0.94) [44/47]
no. of MNP/Indel/Clumped : 153
3 alleles : 138 (0.50) [233/466] (0.84) [102/122]
4 alleles : 12 (0.35) [14/40] (1.42) [17/12]
>=5 alleles : 3 (0.64) [7/11] (0.67) [4/6]
no. of SNP/MNP/Indel/Clumped : 6
4 alleles : 1 (3.00) [3/1] (0.00) [0/3]
>=5 alleles : 5 (0.62) [8/13] (2.00) [12/6]
no. of Reference : 0
====== Other useful categories =====
no. of Block Substitutions : 184751 #equivalent to categories with allele lengths that are the same.
2 alleles : 182466 (1.60) [236793/148036]
3 alleles : 2247 (1.28) [4544/3538]
4 alleles : 34 (1.16) [109/94]
>=5 alleles : 4 (0.76) [13/17]
no. of Complex Substitutions : 159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels
2 alleles : 81508 (0.61) [60312/98113] (0.66) [32479/49029]
3 alleles : 71003 (0.69) [35811/51840] (0.34) [34268/100942]
4 alleles : 5265 (0.49) [2924/5975] (0.30) [3375/11122]
>=5 alleles : 1522 (0.58) [1381/2369] (0.15) [757/5143]
======= Structural variants ========
no. of structural variants : 41217
2 alleles : 38079
deletion : 13135
insertion : 16451
mobile element : 16253
ALU : 12513
LINE1 : 2911
SVA : 829
numt : 198
duplication : 664
inversion : 100
copy number variation : 7729
>=3 alleles : 3138
copy number variation : 3138
========= General summary ==========
no. of observed variants : 79449759
no. of unclassified variants : 0
Implementation
This is implemented in vt.
Maintained by
This page is maintained by Adrian.