SAM: Difference between revisions

From Genome Analysis Wiki
Jump to navigationJump to search
No edit summary
No edit summary
Line 12: Line 12:
Both SAM & BAM files contain a header section and an alignment section.
Both SAM & BAM files contain a header section and an alignment section.
The header section may contain information about the entire file and additional information for alignments.  The alignments then associate themselves with specific header information.
The header section may contain information about the entire file and additional information for alignments.  The alignments then associate themselves with specific header information.
The alignment section contains the information for each sequence about where/how it aligns to the reference genome.


=== What Information Does SAM/BAM Have for an Alignment ===
=== What Information Does SAM/BAM Have for an Alignment ===
Line 33: Line 35:
* leftmost position of where this alignment maps to the reference, POS.  For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based.  Beware to always use the correct base when referencing positions.
* leftmost position of where this alignment maps to the reference, POS.  For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based.  Beware to always use the correct base when referencing positions.
* mapping quality, MAPQ, which contains the "phred-scaled posterior probability that the mapping position" is wrong. (from SAM-1.pdf)
* mapping quality, MAPQ, which contains the "phred-scaled posterior probability that the mapping position" is wrong. (from SAM-1.pdf)
* string indicating alignment information that allows the storing of clipped, CIGAR
* string indicating alignment information that allows the storing of clipped, [[SAM#What is a CIGAR?|CIGAR]]
* the reference sequence name of the next alignment in this group, MRNM or RNEXT.  In paired alignments, it is the mate's reference sequence name. (A group is alignments with the same query name.)
* the reference sequence name of the next alignment in this group, MRNM or RNEXT.  In paired alignments, it is the mate's reference sequence name. (A group is alignments with the same query name.)
* leftmost position of where the next alignment in this group maps to the reference, MPOS or PNEXT.  For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based.  Beware to always use the correct base when referencing positions.
* leftmost position of where the next alignment in this group maps to the reference, MPOS or PNEXT.  For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based.  Beware to always use the correct base when referencing positions.

Revision as of 14:13, 29 July 2010

What is SAM

The SAM Format is a text format for storing aligned reads in a series of tab delimited ASCII columns.

Most often it is generated as a human readable projection of its sister BAM format, which can store data in a compact, indexed, binary representation.

The current definition of the format is at [BAM/SAM Specification].


What Information is in SAM & BAM

SAM files and BAM files contain the same information, but in a different format. Refer to the specs to see a format description.

Both SAM & BAM files contain a header section and an alignment section. The header section may contain information about the entire file and additional information for alignments. The alignments then associate themselves with specific header information.

The alignment section contains the information for each sequence about where/how it aligns to the reference genome.

What Information Does SAM/BAM Have for an Alignment

Each Alignment has:

  • query name, QNAME (SAM)/read_name (BAM). It is used to group/identify alignments that are together, like paired alignments or a read that appears in multiple alignments.
  • a bitwise set of information describing the alignment, FLAG. Provides the following information:
    • are there multiple fragments?
    • are all fragments properly aligned?
    • is this fragment unmapped?
    • is the next fragment unmapped?
    • is this query the reverse strand?
    • is the next fragment the reverse strand?
    • is this the 1st fragment?
    • is this the last fragment?
    • is this a secondary alignment?
    • did this read fail quality controls?
    • is this read a PCR or optical duplicate?

Not all alignments contain The rest of the alignment fields may be set to default values if the information is unknown.

  • reference sequence name, RNAME, often contains the Chromosome name.
  • leftmost position of where this alignment maps to the reference, POS. For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based. Beware to always use the correct base when referencing positions.
  • mapping quality, MAPQ, which contains the "phred-scaled posterior probability that the mapping position" is wrong. (from SAM-1.pdf)
  • string indicating alignment information that allows the storing of clipped, CIGAR
  • the reference sequence name of the next alignment in this group, MRNM or RNEXT. In paired alignments, it is the mate's reference sequence name. (A group is alignments with the same query name.)
  • leftmost position of where the next alignment in this group maps to the reference, MPOS or PNEXT. For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based. Beware to always use the correct base when referencing positions.
  • length of this group from the leftmost position to the rightmost position, ISIZE or TLEN
  • the query sequence for this alignment, SEQ
  • the query quality for this alignment, QUAL, one for each base in the query sequence.
  • Additional optional information is also contained within the alignment, TAGS. A bunch of different information can be stored here and they appear as key/value pairs. See the spec for a detailed list of commonly used tags and what they mean.

What is a CIGAR?

You may have heard the term CIGAR, but wondered what it means. Hopefully this section will help clarify it.

Example SAM

Example Alignments

This is what the alignment section of a SAM file looks like:

1:497:R:-272+13M17D24M	113	1	497	37	37M	15	100338662	0	CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG	0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>>	XT:A:U	NM:i:0	SM:i:37	AM:i:0	X0:i:1	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:37
19:20389:F:275+18M2D19M	99	1	17644	0	37M	=	17919	314	TATGACTGCTAATAATACCTACACATGTTAGAACCAT	>>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9	XT:A:R	NM:i:0	SM:i:0	AM:i:0	X0:i:4	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:37
19:20389:F:275+18M2D19M	147	1	17919	0	18M2D19M	=	17644	-314	GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT	;44999;499<8<8<<<8<<><<<<><7<;<<<>><<	XT:A:R	NM:i:2	SM:i:0	AM:i:0	X0:i:4	X1:i:0	XM:i:0	XO:i:1	XG:i:2	MD:Z:18^CA19
9:21597+10M2I25M:R:-209	83	1	21678	0	8M2I27M	=	21469	-244	CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT	<;9<<5><<<<><<<>><<><>><9>><>>>9>>><>	XT:A:R	NM:i:2	SM:i:0	AM:i:0	X0:i:5	X1:i:0	XM:i:0	XO:i:1	XG:i:2	MD:Z:35

In this example, the fields are:

Field Alignment 1 Alignment 2 Alignment 3 Alignment 4
QNAME 1:497:R:-272+13M17D24M 19:20389:F:275+18M2D19M 19:20389:F:275+18M2D19M 9:21597+10M2I25M:R:-209
FLAG 113 99 147 83
RNAME 1 1 1 1
POS 497 17644 17919 21678
MAPQ 37 0 0 0
CIGAR 37M 37M 18M2D19M 8M2I27M
MRNM/RNEXT 15 = = =
MPOS/PNEXT 100338662 17919 17644 21469
ISIZE/TLEN 0 314
SEQ CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG TATGACTGCTAATAATACCTACACATGTTAGAACCAT GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT
QUAL 0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>> >>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9 ;44999;499<8<8<<<8<<><<<<><7<;<<<>><< <;9<<5><<<<><<<>><<><>><9>><>>>9>>><>
TAGs XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37 XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:18^CA19 XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:35