http://genome.sph.umich.edu/w/index.php?title=An_example_of_using_libcsg&feed=atom&action=history
An example of using libcsg - Revision history
2024-03-28T13:42:22Z
Revision history for this page on the wiki
MediaWiki 1.35.9
http://genome.sph.umich.edu/w/index.php?title=An_example_of_using_libcsg&diff=269&oldid=prev
Zhanxw at 04:39, 15 January 2010
2010-01-15T04:39:34Z
<p></p>
<table class="diff diff-contentalign-left diff-editfont-monospace" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 04:39, 15 January 2010</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l78" >Line 78:</td>
<td colspan="2" class="diff-lineno">Line 78:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>My way to compile this source code into executable file is: </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>My way to compile this source code into executable file is: </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>g++ <del class="diffchange diffchange-inline">-g </del>-o Main Main.cpp libcsg/libcsg.a -I libcsg -lz<br> </div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>g++ -o Main Main.cpp libcsg/libcsg.a -I<ins class="diffchange diffchange-inline">./</ins>libcsg -lz<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>where "libcsg" refers to all source code checked out from repository and contains files including "StringArray.h" and etc. </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>where "libcsg" refers to all source code checked out from repository and contains files including "StringArray.h" and etc. </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>In large projects, Makefile is used, and an example can be found in "csg/karma" directory.</div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>In large projects, Makefile is used, and an example can be found in "csg/karma" directory. </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div><br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div><br> </div></td></tr>
</table>
Zhanxw
http://genome.sph.umich.edu/w/index.php?title=An_example_of_using_libcsg&diff=268&oldid=prev
Zhanxw at 04:38, 15 January 2010
2010-01-15T04:38:42Z
<p></p>
<table class="diff diff-contentalign-left diff-editfont-monospace" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 04:38, 15 January 2010</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"><br> </ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The purpose of this program is (1) to extract a range of text from a input file, and count there frequencies. (2) count which line have the same text as the first line<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The purpose of this program is (1) to extract a range of text from a input file, and count there frequencies. (2) count which line have the same text as the first line<br> </div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l68" >Line 68:</td>
<td colspan="2" class="diff-lineno">Line 68:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> }</source> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> }</source> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"><br> </ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>A example input, say INPUT.txt, is like:<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>A example input, say INPUT.txt, is like:<br> </div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l74" >Line 74:</td>
<td colspan="2" class="diff-lineno">Line 74:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>WTCCC66061-&gt;WTCCC66061 HAPLO1 AGACTCTGATAGCGATAACC<br>WTCCC66061-&gt;WTCCC66061 HAPLO2 GGGTTCCGATGGCGATAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO1 AGACTCTGATGGCGCTAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO2 AGACTCTGATAGCGATGATC<br>WTCCC66063-&gt;WTCCC66063 HAPLO1 AGACTCTTATGGCGCTAGCC<br>WTCCC66063-&gt;WTCCC66063 HAPLO2 AGACTCTTATAGCGATAACC<br>WTCCC66064-&gt;WTCCC66064 HAPLO1 AGACTCTGATGGCGATAGCC<br>WTCCC66064-&gt;WTCCC66064 HAPLO2 AGACTCTGATGACGCTAGCC<br>WTCCC66065-&gt;WTCCC66065 HAPLO1 AGACTCTGATGGCGATAACC<br>WTCCC66065-&gt;WTCCC66065 HAPLO2 AGACTCTGATGGCGATAGCC<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>WTCCC66061-&gt;WTCCC66061 HAPLO1 AGACTCTGATAGCGATAACC<br>WTCCC66061-&gt;WTCCC66061 HAPLO2 GGGTTCCGATGGCGATAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO1 AGACTCTGATGGCGCTAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO2 AGACTCTGATAGCGATGATC<br>WTCCC66063-&gt;WTCCC66063 HAPLO1 AGACTCTTATGGCGCTAGCC<br>WTCCC66063-&gt;WTCCC66063 HAPLO2 AGACTCTTATAGCGATAACC<br>WTCCC66064-&gt;WTCCC66064 HAPLO1 AGACTCTGATGGCGATAGCC<br>WTCCC66064-&gt;WTCCC66064 HAPLO2 AGACTCTGATGACGCTAGCC<br>WTCCC66065-&gt;WTCCC66065 HAPLO1 AGACTCTGATGGCGATAACC<br>WTCCC66065-&gt;WTCCC66065 HAPLO2 AGACTCTGATGGCGATAGCC<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"><br> </ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>My way to compile this source code into executable file is: </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>My way to compile this source code into executable file is: </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>g++ -g -o Main Main.cpp libcsg/libcsg.a -I libcsg -lz<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>g++ -g -o Main Main.cpp libcsg/libcsg.a -I libcsg -lz<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>where "libcsg" refers to all source code checked out from repository and contains files including "StringArray.h" and etc. </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>where "libcsg" refers to all source code checked out from repository and contains files including "StringArray.h" and etc. </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">In large projects, Makefile is used, and an example can be found in "csg/karma" directory.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"><br> </ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>And if we run "./Main -h INPUT.txt -f 1 -t 3". It means we want to read INPUT.txt, get the text range from 1-3 (because of 0-indexed, actually it is from the second character to fourth character), count the pattern frequency, and also find out which line has the same text in range as the first line does. The ouput looks like<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>And if we run "./Main -h INPUT.txt -f 1 -t 3". It means we want to read INPUT.txt, get the text range from 1-3 (because of 0-indexed, actually it is from the second character to fourth character), count the pattern frequency, and also find out which line has the same text in range as the first line does. The ouput looks like<br> </div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l90" >Line 90:</td>
<td colspan="2" class="diff-lineno">Line 92:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Some Notes</div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Some Notes </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br> </div></td></tr>
</table>
Zhanxw
http://genome.sph.umich.edu/w/index.php?title=An_example_of_using_libcsg&diff=267&oldid=prev
Zhanxw at 04:37, 15 January 2010
2010-01-15T04:37:45Z
<p></p>
<table class="diff diff-contentalign-left diff-editfont-monospace" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 04:37, 15 January 2010</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The purpose of this program is (1) to extract a range of text from a input file, and count there frequencies. (2) count which line have the same text as the first line<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The purpose of this program is (1) to extract a range of text from a input file, and count there frequencies. (2) count which line have the same text as the first line<br> </div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l66" >Line 66:</td>
<td colspan="2" class="diff-lineno">Line 68:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> }</source> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> }</source> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>A example input, say INPUT.txt is like:<br> </div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>A example input, say INPUT.txt<ins class="diffchange diffchange-inline">, </ins>is like:<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>WTCCC66061-&gt;WTCCC66061 HAPLO1 AGACTCTGATAGCGATAACC<br>WTCCC66061-&gt;WTCCC66061 HAPLO2 GGGTTCCGATGGCGATAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO1 AGACTCTGATGGCGCTAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO2 AGACTCTGATAGCGATGATC<br>WTCCC66063-&gt;WTCCC66063 HAPLO1 AGACTCTTATGGCGCTAGCC<br>WTCCC66063-&gt;WTCCC66063 HAPLO2 AGACTCTTATAGCGATAACC<br>WTCCC66064-&gt;WTCCC66064 HAPLO1 AGACTCTGATGGCGATAGCC<br>WTCCC66064-&gt;WTCCC66064 HAPLO2 AGACTCTGATGACGCTAGCC<br>WTCCC66065-&gt;WTCCC66065 HAPLO1 AGACTCTGATGGCGATAACC<br>WTCCC66065-&gt;WTCCC66065 HAPLO2 AGACTCTGATGGCGATAGCC<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>WTCCC66061-&gt;WTCCC66061 HAPLO1 AGACTCTGATAGCGATAACC<br>WTCCC66061-&gt;WTCCC66061 HAPLO2 GGGTTCCGATGGCGATAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO1 AGACTCTGATGGCGCTAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO2 AGACTCTGATAGCGATGATC<br>WTCCC66063-&gt;WTCCC66063 HAPLO1 AGACTCTTATGGCGCTAGCC<br>WTCCC66063-&gt;WTCCC66063 HAPLO2 AGACTCTTATAGCGATAACC<br>WTCCC66064-&gt;WTCCC66064 HAPLO1 AGACTCTGATGGCGATAGCC<br>WTCCC66064-&gt;WTCCC66064 HAPLO2 AGACTCTGATGACGCTAGCC<br>WTCCC66065-&gt;WTCCC66065 HAPLO1 AGACTCTGATGGCGATAACC<br>WTCCC66065-&gt;WTCCC66065 HAPLO2 AGACTCTGATGGCGATAGCC<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>And if we run "<del class="diffchange diffchange-inline">extractHaplo </del>-h INPUT.txt -f 1 -t 3". It means we want to read INPUT.txt, get the text range from 1-3 (because of 0-indexed, actually it is from the second character to fourth character), count the pattern frequency, and also find out which line has the same text in range as the first line does. The ouput looks like<br> </div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">My way to compile this source code into executable file is: </ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">g++ -g -o Main Main.cpp libcsg/libcsg.a -I libcsg -lz<br></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">where "libcsg" refers to all source code checked out from repository and contains files including "StringArray.h" and etc. </ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>And if we run "<ins class="diffchange diffchange-inline">./Main </ins>-h INPUT.txt -f 1 -t 3". It means we want to read INPUT.txt, get the text range from 1-3 (because of 0-indexed, actually it is from the second character to fourth character), count the pattern frequency, and also find out which line has the same text in range as the first line does. The ouput looks like<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The following parameters are in effect:<br> Haplotype File&nbsp;: INPUT.txt (-hname)<br> From Position&nbsp;: 1 (-f9999)<br> To Position&nbsp;: 3 (-t9999) </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The following parameters are in effect:<br> Haplotype File&nbsp;: INPUT.txt (-hname)<br> From Position&nbsp;: 1 (-f9999)<br> To Position&nbsp;: 3 (-t9999) </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">Some Notes</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br> </div></td></tr>
</table>
Zhanxw
http://genome.sph.umich.edu/w/index.php?title=An_example_of_using_libcsg&diff=266&oldid=prev
Zhanxw at 04:33, 15 January 2010
2010-01-15T04:33:36Z
<p></p>
<table class="diff diff-contentalign-left diff-editfont-monospace" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 04:33, 15 January 2010</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l38" >Line 38:</td>
<td colspan="2" class="diff-lineno">Line 38:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> tokens.ReplaceTokens(buffer);</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> tokens.ReplaceTokens(buffer);</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> if (buffer.Length() > 0 <del class="diffchange diffchange-inline">&& </del>tokens.Length() != 3)</div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> if (buffer.Length() > 0<ins class="diffchange diffchange-inline">) continue;</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> if (</ins>tokens.Length() != 3)</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> {</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> {</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> printf("Expect 3 words per line but the line beginning with \"%.10s\" looks different ...", (const char *) buffer);</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> printf("Expect 3 words per line but the line beginning with \"%.10s\" looks different ...", (const char *) buffer);</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l73" >Line 73:</td>
<td colspan="2" class="diff-lineno">Line 74:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The following parameters are in effect:<br> Haplotype File&nbsp;: INPUT.txt (-hname)<br> From Position&nbsp;: 1 (-f9999)<br> To Position&nbsp;: 3 (-t9999) </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>The following parameters are in effect:<br> Haplotype File&nbsp;: INPUT.txt (-hname)<br> From Position&nbsp;: 1 (-f9999)<br> To Position&nbsp;: 3 (-t9999) </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<del class="diffchange diffchange-inline"><br>60 1</del><br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br> </div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br> </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br> </div></td></tr>
</table>
Zhanxw
http://genome.sph.umich.edu/w/index.php?title=An_example_of_using_libcsg&diff=265&oldid=prev
Zhanxw at 23:15, 14 January 2010
2010-01-14T23:15:10Z
<p></p>
<table class="diff diff-contentalign-left diff-editfont-monospace" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 23:15, 14 January 2010</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The purpose of this program is (1) to extract a range of text from a input file, and count there frequencies. (2) count which line have the same text as the first line<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The purpose of this program is (1) to extract a range of text from a input file, and count there frequencies. (2) count which line have the same text as the first line<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The code will open a file (specified by -h parameter), take the third field, obtain a range of text (range is specified by starting position using -f and ending position using -t).<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The code will open a file (specified by -h parameter), take the third field, obtain a range of text (range is specified by starting position using -f and ending position using -t).<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div><source lang="c">#include "StringArray.h"</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div><source lang="c">#include "StringArray.h"</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l63" >Line 63:</td>
<td colspan="2" class="diff-lineno">Line 63:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> ifclose(input);</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div> ifclose(input);</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> }</source></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> }</source> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>A example input, say INPUT.txt is like:<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>A example input, say INPUT.txt is like:<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>WTCCC66061-&gt;WTCCC66061 HAPLO1 AGACTCTGATAGCGATAACC<br>WTCCC66061-&gt;WTCCC66061 HAPLO2 GGGTTCCGATGGCGATAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO1 AGACTCTGATGGCGCTAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO2 AGACTCTGATAGCGATGATC<br>WTCCC66063-&gt;WTCCC66063 HAPLO1 AGACTCTTATGGCGCTAGCC<br>WTCCC66063-&gt;WTCCC66063 HAPLO2 AGACTCTTATAGCGATAACC<br>WTCCC66064-&gt;WTCCC66064 HAPLO1 AGACTCTGATGGCGATAGCC<br>WTCCC66064-&gt;WTCCC66064 HAPLO2 AGACTCTGATGACGCTAGCC<br>WTCCC66065-&gt;WTCCC66065 HAPLO1 AGACTCTGATGGCGATAACC<br>WTCCC66065-&gt;WTCCC66065 HAPLO2 AGACTCTGATGGCGATAGCC<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>WTCCC66061-&gt;WTCCC66061 HAPLO1 AGACTCTGATAGCGATAACC<br>WTCCC66061-&gt;WTCCC66061 HAPLO2 GGGTTCCGATGGCGATAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO1 AGACTCTGATGGCGCTAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO2 AGACTCTGATAGCGATGATC<br>WTCCC66063-&gt;WTCCC66063 HAPLO1 AGACTCTTATGGCGCTAGCC<br>WTCCC66063-&gt;WTCCC66063 HAPLO2 AGACTCTTATAGCGATAACC<br>WTCCC66064-&gt;WTCCC66064 HAPLO1 AGACTCTGATGGCGATAGCC<br>WTCCC66064-&gt;WTCCC66064 HAPLO2 AGACTCTGATGACGCTAGCC<br>WTCCC66065-&gt;WTCCC66065 HAPLO1 AGACTCTGATGGCGATAACC<br>WTCCC66065-&gt;WTCCC66065 HAPLO2 AGACTCTGATGGCGATAGCC<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>And if we run "extractHaplo -h INPUT.txt -f 1 -t 3", and the ouput looks like<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>And if we run "extractHaplo -h INPUT.txt -f 1 -t 3"<ins class="diffchange diffchange-inline">. It means we want to read INPUT.txt, get the text range from 1-3 (because of 0-indexed, actually it is from the second character to fourth character), count the pattern frequency</ins>, and <ins class="diffchange diffchange-inline">also find out which line has the same text in range as </ins>the <ins class="diffchange diffchange-inline">first line does. The </ins>ouput looks like<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The following parameters are in effect:<br> Haplotype File : INPUT.txt (-hname)<br> From Position : 1 (-f9999)<br> To Position : 3 (-t9999)</div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The following parameters are in effect:<br> Haplotype File<ins class="diffchange diffchange-inline">&nbsp;</ins>: INPUT.txt (-hname)<br> From Position<ins class="diffchange diffchange-inline">&nbsp;</ins>: 1 (-f9999)<br> To Position<ins class="diffchange diffchange-inline">&nbsp;</ins>: 3 (-t9999) </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<br>60 1<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Haplotype Counts<br>GGT 1<br>GAC 9<br>60 1<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br> </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>*To handle strings, we prefer to use String class. In this area, handling string is a versatile task. A String class encapsulate basic operations such as index[], append(+), equality(=), extract(Left, Right, Mid). String class can be seamlessly used with IFILE class to acces file. See the while loop in the example code and notice the function ReadLine().<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*To handle strings, we prefer to use String class. In this area, handling string is a versatile task. A String class encapsulate basic operations such as index[], append(+), equality(=), extract(Left, Right, Mid). String class can be seamlessly used with IFILE class to acces file. See the while loop in the example code and notice the function ReadLine().<br> </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>*To tokenize a String class, we can use StringArray class. It has ReplaceToken() which will store each token field like an array.<br></div></td><td class='diff-marker'>+</td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*To tokenize a String class, we can use StringArray class. It has ReplaceToken() which will store each token field like an array.<br> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To associate a String class to a integer type, there is a class named StringIntHash, important functions are IncrementCount(), Capacity() and SlotInUse().</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*To associate a String class to a integer type, there is a class named StringIntHash, important functions are IncrementCount(), Capacity() and SlotInUse().</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div><br></div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div><br></div></td></tr>
</table>
Zhanxw
http://genome.sph.umich.edu/w/index.php?title=An_example_of_using_libcsg&diff=263&oldid=prev
Zhanxw: Created page with 'Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br> The purpose of this program is (1) to extract a range of text from a input file, and count…'
2010-01-14T22:57:55Z
<p>Created page with 'Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br> The purpose of this program is (1) to extract a range of text from a input file, and count…'</p>
<p><b>New page</b></p><div>Here I showed an example using Goncalo's library (I assume he agreed me to do so).<br><br />
<br />
The purpose of this program is (1) to extract a range of text from a input file, and count there frequencies. (2) count which line have the same text as the first line<br><br />
<br />
The code will open a file (specified by -h parameter), take the third field, obtain a range of text (range is specified by starting position using -f and ending position using -t).<br><br />
<br />
<source lang="c">#include "StringArray.h"<br />
#include "StringHash.h"<br />
#include "Parameters.h"<br />
#include "Error.h"<br />
<br />
int main(int argc, char ** argv)<br />
{<br />
String filename;<br />
int firstMarker = 0, lastMarker = 10;<br />
<br />
ParameterList pl;<br />
<br />
pl.Add(new StringParameter('h', "Haplotype File", filename));<br />
pl.Add(new IntParameter('f', "From Position", firstMarker));<br />
pl.Add(new IntParameter('t', "To Position", lastMarker));<br />
pl.Read(argc, argv);<br />
pl.Status();<br />
<br />
IFILE input = ifopen(filename, "rt");<br />
<br />
if (input == NULL)<br />
error("Failed to open file %s", (const char *) filename);<br />
<br />
String buffer;<br />
StringArray tokens;<br />
StringArray haplos, names;<br />
StringIntHash haploCounts;<br />
<br />
while (!ifeof(input))<br />
{<br />
buffer.ReadLine(input);<br />
tokens.ReplaceTokens(buffer);<br />
<br />
if (buffer.Length() > 0 && tokens.Length() != 3)<br />
{<br />
printf("Expect 3 words per line but the line beginning with \"%.10s\" looks different ...", (const char *) buffer);<br />
continue;<br />
}<br />
<br />
haplos.Push(tokens[2].Mid(firstMarker, lastMarker));<br />
names.Push(tokens[0]);<br />
<br />
haploCounts.IncrementCount(tokens[2].Mid(firstMarker, lastMarker));<br />
<br />
}<br />
<br />
printf("Haplotype Counts\n");<br />
for (int i = 0; i < haploCounts.Capacity(); i++)<br />
if (haploCounts.SlotInUse(i))<br />
printf("%s %d\n", (const char *) haploCounts[i], haploCounts.Integer(i));<br />
<br />
printf("Haplotypes that match the first one\n");<br />
for (int i = 1; i < haplos.Length(); i++)<br />
if (haplos[i] == haplos[0])<br />
printf("%s (%d)\n", (const char *) names[i], i + 1);<br />
printf("\n");<br />
<br />
ifclose(input);<br />
}</source><br />
<br />
A example input, say INPUT.txt is like:<br><br />
<br />
WTCCC66061-&gt;WTCCC66061 HAPLO1 AGACTCTGATAGCGATAACC<br>WTCCC66061-&gt;WTCCC66061 HAPLO2 GGGTTCCGATGGCGATAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO1 AGACTCTGATGGCGCTAACC<br>WTCCC66062-&gt;WTCCC66062 HAPLO2 AGACTCTGATAGCGATGATC<br>WTCCC66063-&gt;WTCCC66063 HAPLO1 AGACTCTTATGGCGCTAGCC<br>WTCCC66063-&gt;WTCCC66063 HAPLO2 AGACTCTTATAGCGATAACC<br>WTCCC66064-&gt;WTCCC66064 HAPLO1 AGACTCTGATGGCGATAGCC<br>WTCCC66064-&gt;WTCCC66064 HAPLO2 AGACTCTGATGACGCTAGCC<br>WTCCC66065-&gt;WTCCC66065 HAPLO1 AGACTCTGATGGCGATAACC<br>WTCCC66065-&gt;WTCCC66065 HAPLO2 AGACTCTGATGGCGATAGCC<br><br />
<br />
And if we run "extractHaplo -h INPUT.txt -f 1 -t 3", and the ouput looks like<br><br />
<br />
The following parameters are in effect:<br> Haplotype File : INPUT.txt (-hname)<br> From Position : 1 (-f9999)<br> To Position : 3 (-t9999)<br />
<br />
Haplotype Counts<br>GGT 1<br>GAC 9<br>60 1<br>Haplotypes that match the first one<br>WTCCC66062-&gt;WTCCC66062 (3)<br>WTCCC66062-&gt;WTCCC66062 (4)<br>WTCCC66063-&gt;WTCCC66063 (5)<br>WTCCC66063-&gt;WTCCC66063 (6)<br>WTCCC66064-&gt;WTCCC66064 (7)<br>WTCCC66064-&gt;WTCCC66064 (8)<br>WTCCC66065-&gt;WTCCC66065 (9)<br>WTCCC66065-&gt;WTCCC66065 (10)<br><br><br />
<br />
*To read a file, use IFILE class, which is wrapper for read/write file. A particular useful thing is that it handle gzipped file transparently. Important functions are: ifopen(), ifclose().<br><br />
*To handle strings, we prefer to use String class. In this area, handling string is a versatile task. A String class encapsulate basic operations such as index[], append(+), equality(=), extract(Left, Right, Mid). String class can be seamlessly used with IFILE class to acces file. See the while loop in the example code and notice the function ReadLine().<br><br />
*To tokenize a String class, we can use StringArray class. It has ReplaceToken() which will store each token field like an array.<br><br />
*To associate a String class to a integer type, there is a class named StringIntHash, important functions are IncrementCount(), Capacity() and SlotInUse().<br />
<br />
<br></div>
Zhanxw