Line 113: |
Line 113: |
| === Example Output === | | === Example Output === |
| <pre> | | <pre> |
− | The following parameters are in effect: | + | The following parameters are available. Ones with "[]" are in effect: |
| | | |
| Input Parameters | | Input Parameters |
Line 162: |
Line 162: |
| --bamIndex : the path/name of the bam index file | | --bamIndex : the path/name of the bam index file |
| (if not specified, uses the --in value + ".bai") | | (if not specified, uses the --in value + ".bai") |
| + | --refName : the BAM reference Name to read (either this or refID can be specified) |
| --refID : the BAM reference ID to read (defaults to -1: unmapped) | | --refID : the BAM reference ID to read (defaults to -1: unmapped) |
| --start : the 0-based start position (defaults to -1) | | --start : the 0-based start position (defaults to -1) |
Line 169: |
Line 170: |
| === Usage === | | === Usage === |
| | | |
− | ./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] | + | ./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] |
− | | + | |
| === Return Value === | | === Return Value === |
| * 0: all records are successfully read and written. | | * 0: all records are successfully read and written. |
Line 177: |
Line 178: |
| === Example Output === | | === Example Output === |
| <pre> | | <pre> |
− | The following parameters are in effect: | + | The following parameters are available. Ones with "[]" are in effect: |
| | | |
| Input Parameters | | Input Parameters |
− | --in [test/testFiles/sortedBam.bam], --out [t.sam], --bamIndex [], --refID, | + | --in [test/testFiles/sortedBam.bam], --out [t.sam], --bamIndex [], |
− | --start [1], --end [100], --noeof
| + | --refName [], --refID, --start [1], --end [100], --noeof |
| | | |
| Wrote t.sam with 2 records. | | Wrote t.sam with 2 records. |
Line 236: |
Line 237: |
| outputFile.sam/bam - path/name of the output file | | outputFile.sam/bam - path/name of the output file |
| bamIndexFile - path/name of the BAM index file | | bamIndexFile - path/name of the BAM index file |
− | Optional Parameters:
| |
− | ref# - the reference number to print (optional) defaults to print all
| |
| </pre> | | </pre> |
| | | |
Line 270: |
Line 269: |
| * 0: the reference file was successfully read. | | * 0: the reference file was successfully read. |
| * non-0: the reference file was not successfully read. | | * non-0: the reference file was not successfully read. |
| + | |
| + | === Example Output === |
| + | <pre> |
| + | The following parameters are available. Ones with "[]" are in effect: |
| + | Input Parameters |
| + | --refFile [/home/mktrost/data/human.g1k.v37.fa], --refName [1], |
| + | --start [43000], --end [-1], --numBases [71] |
| + | |
| + | open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done. |
| + | GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA |
| + | </pre> |