Difference between revisions of "BamUtil"
(→diff) |
|||
Line 285: | Line 285: | ||
<span style="color:#D2691E">'''***Coming Soon***'''</span> | <span style="color:#D2691E">'''***Coming Soon***'''</span> | ||
− | The <code>diff</code> option on the bam executable prints the difference between two SAM/BAM files. This can be used to compare the outputs of running a SAM/BAM through different tools/versions of tools. | + | The <code>diff</code> option on the bam executable prints the difference between two coordinate sorted SAM/BAM files. This can be used to compare the outputs of running a SAM/BAM through different tools/versions of tools. |
+ | |||
+ | The <code>diff</code> tool compares records that have the same Read Name and Fragment (from the flag). If a matching ReadName & Fragment is not found, the record is considered to be different. | ||
+ | |||
+ | <code>diff</code> assumes the files are coordinate sorted and uses this assumption for determining how long to store a record before determining that the other file does not contain a matching ReadName/Fragment. If the files are not coordinate sorted, this logic does not work. | ||
+ | |||
+ | By default, just the chromosome/position and cigar are compared for each record. | ||
+ | |||
+ | Options are available to compare: | ||
+ | * sequence | ||
+ | * base quality | ||
+ | * specified tags | ||
+ | * turn off position comparison | ||
+ | * turn off cigar comparison | ||
=== Parameters === | === Parameters === | ||
<pre> | <pre> | ||
Required Parameters: | Required Parameters: | ||
− | --in1 : first SAM/BAM file to be diffed | + | --in1 : first coordinate sorted SAM/BAM file to be diffed |
− | --in2 : second SAM/BAM file to be diffed | + | --in2 : second coordinate sorted SAM/BAM file to be diffed |
Optional Parameters: | Optional Parameters: | ||
--seq : diff the sequence bases. | --seq : diff the sequence bases. | ||
Line 313: | Line 326: | ||
=== Output Format === | === Output Format === | ||
− | + | There are 2 types of differences. | |
+ | * ReadName/Fragment combo is in one file, but not in the other file within the window set by recPoolSize & posDiff | ||
+ | * ReadName/Fragment combo is in both files, but at least one of the specified fields to diff is different | ||
== readReference == | == readReference == |
Revision as of 10:52, 19 May 2011
bam Executable
When statgen is compiled, the SAM/BAM executable, "bam" is generated in the statgen/src/bin/ directory.
The software reads the beginning of an input file to determine if it is SAM/BAM. To determine the format (SAM/BAM) of the output file, the software checks the output file's extension. If the extension is ".bam" it writes a BAM file, otherwise it writes a SAM file.
The bam executable has the following functions.
- validate - Read and Validate a SAM/BAM file
- convert - Read a SAM/BAM file and write as a SAM/BAM file
- dumpHeader - Print SAM/BAM header
- splitChromosome - Split BAM by Chromosome
- writeRegion - Write the alignments in the indexed BAM file that fall into the specified region
- dumpRefInfo - Print SAM/BAM Reference Information
- dumpIndex - Dump a BAM index file into an easy to read text version
- readIndexedBam - Read an indexed BAM file reference by reference id -1 to the max reference id and write it out as a SAM/BAM file
- filter - Filter reads by clipping ends with too high of a mismatch percentage and by marking reads unmapped if the quality of mismatches is too high
- readReference - Print the reference string for the specified region
- diff - Print the diffs between 2 bams
This executable is built using StatGenLibrary: BAM.
Just running ./bam will print the Usage information for the bam executable.
validate
The validate
option on the bam executable reads and validates a SAM/BAM file. This option is documented at: BamValidator
convert
The convert
option on the bam executable reads a SAM/BAM file and writes it as a SAM/BAM file.
The executable converts the input file into the format of the output file. So if you want to convert a BAM file to a SAM file, from the pipeline/bam/ directory you just call:
./bam --in <bamFile>.bam --out <newSamFile>.sam
Don't forget to put in the paths to the executable and your test files.
Sequence Representation
The sequence parameter options specify how to represent the sequence if the reference is specified (refFile option). If the reference is not specified or seqOrig is specified, no modifications are made to the sequence. If the reference and seqBases is specified, any matches between the sequence and the reference are represented in the sequence as the appropriate base. If the reference and seqEquals is specified, any matches between the sequence and the reference are represented in the sequence as '='.
Examples
ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AATAA CTAGA T AGGG Reference: TAACCCTA ACCCT A Sequence with Orig: AATAACTAGATAGGG Sequence with Bases: AATAACTAGATAGGG Sequence with Equals: AA======G===GGG
ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AATGA CTGGA T AGGG Reference: TAACCCTA ACCCT A Sequence with Orig: AATGACTGGATAGGG Sequence with Bases: AATGACTGGATAGGG Sequence with Equals: AA=G===GG===GGG
ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AAT=A CT=GA T AGGG Reference: TAACCCTA ACCCT A Sequence with Orig: AAT=ACT=GATAGGG Sequence with Bases: AATGACTGGATAGGG Sequence with Equals: AA======G===GGG
ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AA=== ===G= = =GGG Reference: TAACCCTA ACCCT A Sequence with Orig: AA======G===GGG Sequence with Bases: AATAACTAGATAGGG Sequence with Equals: AA======G===GGG
Parameters
Required Parameters: --in : the SAM/BAM file to be read --out : the SAM/BAM file to be written Optional Parameters: --refFile : reference file name --noeof : do not expect an EOF block on a bam file. --params : print the parameter settings Optional Sequence Parameters (only specify one): --seqOrig : Leave the sequence as is (default & used if reference is not specified). --seqBases : Convert any '=' in the sequence to the appropriate base using the reference (requires --ref). --seqEquals : Convert any bases that match the reference to '=' (requires --ref).
Usage
./bam convert --in <inputFile> --out <outputFile.sam/bam/ubam (ubam is uncompressed bam)> [--refFile <reference filename>] [--seqBases|--seqEquals|--seqOrig] [--noeof] [--params]
Return Value
Returns the SamStatus for the reads/writes.
Example Output
Number of records read = 10 Number of records written = 10
dumpHeader
The dumpHeader
option on the bam executable prints the header of the specified SAM/BAM file to cout.
Parameters
Required Parameters: filename : the sam/bam filename whose header should be printed.
Usage
./bam dumpHeader <inputFile>
Return Value
- 0: the header was successfully read and printed.
- non-0: the header was not successfully read or was not printed. (Returns the SamStatus.)
Example Output
@SQ SN:1 LN:247249719 @SQ SN:2 LN:242951149 @SQ SN:3 LN:199501827
splitChromosome
The splitChromosome
option on the bam executable splits an indexed BAM file into multiple files based on the Chromosome (Reference Name).
The files all have the same base name, but with an _# where # corresponds with the associated reference id from the BAM file.
Parameters
Required Parameters: --in : the BAM file to be split --out : the base filename for the SAM/BAM files to write into. Does not include the extension. _N will be appended to the basename where N indicates the Chromosome. Optional Parameters: --noeof : do not expect an EOF block on a bam file. --bamIndex : the path/name of the bam index file (if not specified, uses the --in value + ".bai") --bamout : write the output files in BAM format (default). --samout : write the output files in SAM format. --params : print the parameter settings
Usage
./bam splitChromosome --in <inputFilename> --out <outputFileBaseName> [--bamIndex <bamIndexFile>] [--noeof] [--bamout|--samout] [--params]
Return Value
- 0: all records are successfully read and written.
- non-0: at least one record was not successfully read or written.
Example Output
Reference ID -1 has 2 records Reference ID 0 has 5 records Reference ID 1 has 2 records Reference ID 2 has 1 records Reference ID 3 has 0 records Reference ID 4 has 0 records Reference ID 5 has 0 records Reference ID 6 has 0 records Reference ID 7 has 0 records Reference ID 8 has 0 records Reference ID 9 has 0 records Reference ID 10 has 0 records Reference ID 11 has 0 records Reference ID 12 has 0 records Reference ID 13 has 0 records Reference ID 14 has 0 records Reference ID 15 has 0 records Reference ID 16 has 0 records Reference ID 17 has 0 records Reference ID 18 has 0 records Reference ID 19 has 0 records Reference ID 20 has 0 records Reference ID 21 has 0 records Reference ID 22 has 0 records Number of records = 10 Returning: 0 (SUCCESS)
writeRegion
The writeRegion
option on the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position).
Parameters
Required Parameters: --in : the BAM file to be read --out : the SAM/BAM file to write to Optional Parameters: --noeof : do not expect an EOF block on a bam file. --bamIndex : the path/name of the bam index file (if not specified, uses the --in value + ".bai") --refName : the BAM reference Name to read (either this or refID can be specified) --refID : the BAM reference ID to read (defaults to -1: unmapped) --start : inclusive 0-based start position (defaults to -1) --end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference) --params : print the parameter settings
Usage
./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] [--params]
Return Value
- 0: all records are successfully read and written.
- non-0: at least one record was not successfully read or written.
Example Output
Wrote t.sam with 2 records.
dumpRefInfo
The dumpRefInfo
option on the bam executable prints the SAM/BAM file's reference information.
Parameters
Required Parameters: --in : the SAM/BAM file to be read Optional Parameters: --noeof : do not expect an EOF block on a bam file. --printRecordRefs : print the reference information for the records in the file (grouped by reference). --params : print the parameter settings
Usage
./bam dumpRefInfo --in <inputFilename> [--noeof] [--printRecordRefs] [--params]
Return Value
- 0: the file was processed successfully.
- non-0: the file was not processed successfully.
dumpIndex
The dumpIndex
option on the bam executable prints BAM index file in an easy to read format.
Parameters
Required Parameters: --bamIndex : the path/name of the bam index file to display Optional Parameters: --refID : the reference ID to read, defaults to print all --summary : only print a summary - 1 line per reference. --params : print the parameter settings
Usage
./bam dumpIndex --bamIndex <bamIndexFile> [--refID <ref#>] [--summary] [--params]
Return Value
- 0: the BAM index file was processed successfully.
- non-0: the BAM index file was not processed successfully.
readIndexedBam
The readIndexedBam
option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and writes it out as a SAM/BAM file.
Parameters
Required Parameters: inputFilename - path/name of the input BAM file outputFile.sam/bam - path/name of the output file bamIndexFile - path/name of the BAM index file
Usage
./bam readIndexedBam <inputFilename> <outputFile.sam/bam> <bamIndexFile>
Return Value
- 0
filter
The filter
option on the bam executable filters the reads in a a SAM/BAM file. This option is documented at: Bam Executable: Filter
diff
***Coming Soon***
The diff
option on the bam executable prints the difference between two coordinate sorted SAM/BAM files. This can be used to compare the outputs of running a SAM/BAM through different tools/versions of tools.
The diff
tool compares records that have the same Read Name and Fragment (from the flag). If a matching ReadName & Fragment is not found, the record is considered to be different.
diff
assumes the files are coordinate sorted and uses this assumption for determining how long to store a record before determining that the other file does not contain a matching ReadName/Fragment. If the files are not coordinate sorted, this logic does not work.
By default, just the chromosome/position and cigar are compared for each record.
Options are available to compare:
- sequence
- base quality
- specified tags
- turn off position comparison
- turn off cigar comparison
Parameters
Required Parameters: --in1 : first coordinate sorted SAM/BAM file to be diffed --in2 : second coordinate sorted SAM/BAM file to be diffed Optional Parameters: --seq : diff the sequence bases. --baseQual : diff the base qualities. --tags : diff the specified Tags formatted as Tag:Type;Tag:Type;Tag:Type... --noCigar : do not diff the the cigars. --noPos : do not diff the positions. --onlyDiffs : only print the fields that are different, otherwise for any diff all the fields that are compared are printed. --recPoolSize : number of records to allow to be stored at a time, default value: 1000000 --posDiff : max base pair difference between possibly matching records100000 --noeof : do not expect an EOF block on a bam file. --params : print the parameter settings
Usage
./bam diff --in1 <inputFile> --in2 <inputFile> [--out <outputFile>] [--baseQual] [--tags <Tag:Type[;Tag:Type]*>] [--noCigar] [--noPos] [--onlyDiffs] [--recPoolSize <int>] [--posDiff <int>] [--noeof] [--params]
Return Value
- 0: all records are successfully read and written.
- non-0: an error occurred processing the parameters or reading one of the files.
Output Format
There are 2 types of differences.
- ReadName/Fragment combo is in one file, but not in the other file within the window set by recPoolSize & posDiff
- ReadName/Fragment combo is in both files, but at least one of the specified fields to diff is different
readReference
The readReference
option on the bam executable prints the specified region of the reference sequence in an easy to read format.
Parameters
Required Parameters: --refFile : the reference --refName : the SAM/BAM reference Name to read --start : inclusive 0-based start position (defaults to -1) Required Length Parameter (one but not both needs to be specified): --end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference) --numBases : number of bases from start to display --params : print the parameter settings
Usage
./bam readReference --refFile <referenceFilename> --refName <reference Name> --start <0 based start> --end <0 based end>|--numBases <number of bases> [--params]
Return Value
- 0: the reference file was successfully read.
- non-0: the reference file was not successfully read.
Example Output
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done. GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA