3,045
edits
Changes
From Genome Analysis Wiki
Jump to navigationJump to searchno edit summary
=== Example Output ===
=== Example Output ===
<pre>
<pre>
The following parameters are in effect:
The following parameters are available. Ones with "[]" are in effect:
Input Parameters
Input Parameters
--bamIndex : the path/name of the bam index file
--bamIndex : the path/name of the bam index file
(if not specified, uses the --in value + ".bai")
(if not specified, uses the --in value + ".bai")
--refName : the BAM reference Name to read (either this or refID can be specified)
--refID : the BAM reference ID to read (defaults to -1: unmapped)
--refID : the BAM reference ID to read (defaults to -1: unmapped)
--start : the 0-based start position (defaults to -1)
--start : the 0-based start position (defaults to -1)
=== Usage ===
=== Usage ===
./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof]
./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>]
=== Return Value ===
=== Return Value ===
* 0: all records are successfully read and written.
* 0: all records are successfully read and written.
=== Example Output ===
=== Example Output ===
<pre>
<pre>
The following parameters are in effect:
The following parameters are available. Ones with "[]" are in effect:
Input Parameters
Input Parameters
--in [test/testFiles/sortedBam.bam], --out [t.sam], --bamIndex [], --refID,
--in [test/testFiles/sortedBam.bam], --out [t.sam], --bamIndex [],
--refName [], --refID, --start [1], --end [100], --noeof
Wrote t.sam with 2 records.
Wrote t.sam with 2 records.
outputFile.sam/bam - path/name of the output file
outputFile.sam/bam - path/name of the output file
bamIndexFile - path/name of the BAM index file
bamIndexFile - path/name of the BAM index file
</pre>
</pre>
* 0: the reference file was successfully read.
* 0: the reference file was successfully read.
* non-0: the reference file was not successfully read.
* non-0: the reference file was not successfully read.
=== Example Output ===
<pre>
The following parameters are available. Ones with "[]" are in effect:
Input Parameters
--refFile [/home/mktrost/data/human.g1k.v37.fa], --refName [1],
--start [43000], --end [-1], --numBases [71]
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.
GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA
</pre>
