BamUtil

From Genome Analysis Wiki
Revision as of 18:44, 14 December 2010 by Mktrost (talk | contribs) (→‎convert)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.


bam Executable

When statgen is compiled, the SAM/BAM executable, "bam" is generated in the statgen/src/bin/ directory.

The software reads the beginning of an input file to determine if it is SAM/BAM. To determine the format (SAM/BAM) of the output file, the software checks the output file's extension. If the extension is ".bam" it writes a BAM file, otherwise it writes a SAM file.

The bam executable has the following functions.

This executable is built using StatGenLibrary: BAM.

Just running ./bam will print the Usage information for the bam executable.


validate

The validate option on the bam executable reads and validates a SAM/BAM file. This option is documented at: BamValidator

convert

The convert option on the bam executable reads a SAM/BAM file and writes it as a SAM/BAM file.

The executable converts the input file into the format of the output file. So if you want to convert a BAM file to a SAM file, from the pipeline/bam/ directory you just call:

./bam --in <bamFile>.bam --out <newSamFile>.sam

Don't forget to put in the paths to the executable and your test files.

Sequence Representation

The sequence parameter options specify how to represent the sequence if the reference is specified (refFile option). If the reference is not specified or seqOrig is specified, no modifications are made to the sequence. If the reference and seqBases is specified, any matches between the sequence and the reference are represented in the sequence as the appropriate base. If the reference and seqEquals is specified, any matches between the sequence and the reference are represented in the sequence as '='.

Example

ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AATAA CTAGA T AGGG Reference: TAACCCTA ACCCT A Sequence with Orig: AATAACTAGATAGGG Sequence with Bases: AATAACTAGATAGGG Sequence with Equals: AA======G===GGG

ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AATGA CTGGA T AGGG Reference: TAACCCTA ACCCT A Sequence with Orig: AATGACTGGATAGGG Sequence with Bases: AATGACTGGATAGGG Sequence with Equals: AA=G===GG===GGG

ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AAT=A CT=GA T AGGG Reference: TAACCCTA ACCCT A Sequence with Orig: AAT=ACT=GATAGGG Sequence with Bases: AATGACTGGATAGGG Sequence with Equals: AA======G===GGG

ExtendedCigar: SSMMMDDMMMIMNNNMPMSSS Sequence: AA=== ===G= = =GGG Reference: TAACCCTA ACCCT A Sequence with Orig: AA======G===GGG Sequence with Bases: AATAACTAGATAGGG Sequence with Equals: AA======G===GGG

Parameters

    Required Parameters:
        --in        : the SAM/BAM file to be read
        --out       : the SAM/BAM file to be written
    Optional Parameters:
	--refFile   : reference file name
        --noeof     : do not expect an EOF block on a bam file.
        --params    : print the parameter settings
    Optional Sequence Parameters (only specify one):
	--seqOrig   : Leave the sequence as is (default & used if reference is not specified).
	--seqBases  : Convert any '=' in the sequence to the appropriate base using the reference (requires --ref).
	--seqEquals : Convert any bases that match the reference to '=' (requires --ref).

Usage

./bam convert --in <inputFile> --out <outputFile.sam/bam/ubam (ubam is uncompressed bam)> [--refFile <reference filename>] [--seqBases|--seqEquals|--seqOrig] [--noeof] [--params]


Return Value

Returns the SamStatus for the reads/writes.

Example Output

Number of records read = 10
Number of records written = 10

dumpHeader

The dumpHeader option on the bam executable prints the header of the specified SAM/BAM file to cout.

Parameters

    Required Parameters:
	filename : the sam/bam filename whose header should be printed.

Usage

./bam dumpHeader <inputFile>

Return Value

  • 0: the header was successfully read and printed.
  • non-0: the header was not successfully read or was not printed. (Returns the SamStatus.)


Example Output

@SQ	SN:1	LN:247249719
@SQ	SN:2	LN:242951149
@SQ	SN:3	LN:199501827


splitChromosome

The splitChromosome option on the bam executable splits an indexed BAM file into multiple files based on the Chromosome (Reference Name).

The files all have the same base name, but with an _# where # corresponds with the associated reference id from the BAM file.

Parameters

    Required Parameters:
        --in       : the BAM file to be split
        --out      : the base filename for the SAM/BAM files to write into.  Does not include the extension.
                     _N will be appended to the basename where N indicates the Chromosome.
    Optional Parameters:
        --noeof  : do not expect an EOF block on a bam file.
        --bamIndex : the path/name of the bam index file
                     (if not specified, uses the --in value + ".bai")
        --bamout : write the output files in BAM format (default).
        --samout : write the output files in SAM format.
        --params : print the parameter settings

Usage

./bam splitChromosome --in <inputFilename>  --out <outputFileBaseName> [--bamIndex <bamIndexFile>] [--noeof] [--bamout|--samout] [--params]


Return Value

  • 0: all records are successfully read and written.
  • non-0: at least one record was not successfully read or written.

Example Output

Reference ID -1 has 2 records
Reference ID 0 has 5 records
Reference ID 1 has 2 records
Reference ID 2 has 1 records
Reference ID 3 has 0 records
Reference ID 4 has 0 records
Reference ID 5 has 0 records
Reference ID 6 has 0 records
Reference ID 7 has 0 records
Reference ID 8 has 0 records
Reference ID 9 has 0 records
Reference ID 10 has 0 records
Reference ID 11 has 0 records
Reference ID 12 has 0 records
Reference ID 13 has 0 records
Reference ID 14 has 0 records
Reference ID 15 has 0 records
Reference ID 16 has 0 records
Reference ID 17 has 0 records
Reference ID 18 has 0 records
Reference ID 19 has 0 records
Reference ID 20 has 0 records
Reference ID 21 has 0 records
Reference ID 22 has 0 records
Number of records = 10
Returning: 0 (SUCCESS)


writeRegion

The writeRegion option on the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position).

Parameters

    Required Parameters:
        --in       : the BAM file to be read
        --out      : the SAM/BAM file to write to
    Optional Parameters:
        --noeof  : do not expect an EOF block on a bam file.
        --bamIndex : the path/name of the bam index file
                     (if not specified, uses the --in value + ".bai")
        --refName  : the BAM reference Name to read (either this or refID can be specified)
        --refID    : the BAM reference ID to read (defaults to -1: unmapped)
        --start    : inclusive 0-based start position (defaults to -1)
        --end      : exclusive 0-based end position (defaults to -1: meaning til the end of the reference)
        --params   : print the parameter settings

Usage

./bam writeRegion --in <inputFilename>  --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] [--params]

Return Value

  • 0: all records are successfully read and written.
  • non-0: at least one record was not successfully read or written.

Example Output


Wrote t.sam with 2 records.


dumpRefInfo

The dumpRefInfo option on the bam executable prints the SAM/BAM file's reference information.

Parameters

    Required Parameters:
        --in               : the SAM/BAM file to be read
    Optional Parameters:
        --noeof            : do not expect an EOF block on a bam file.
        --printRecordRefs  : print the reference information for the records in the file (grouped by reference).
        --params           : print the parameter settings

Usage

./bam dumpRefInfo --in <inputFilename> [--noeof] [--printRecordRefs] [--params]

Return Value

  • 0: the file was processed successfully.
  • non-0: the file was not processed successfully.


dumpIndex

The dumpIndex option on the bam executable prints BAM index file in an easy to read format.

Parameters

    Required Parameters:
        --bamIndex : the path/name of the bam index file to display
    Optional Parameters:
        --refID    : the reference ID to read, defaults to print all
        --summary  : only print a summary - 1 line per reference.
        --params   : print the parameter settings

Usage

./bam dumpIndex --bamIndex <bamIndexFile> [--refID <ref#>] [--summary] [--params]

Return Value

  • 0: the BAM index file was processed successfully.
  • non-0: the BAM index file was not processed successfully.


readIndexedBam

The readIndexedBam option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and writes it out as a SAM/BAM file.

Parameters

	Required Parameters:
		inputFilename      - path/name of the input BAM file
		outputFile.sam/bam - path/name of the output file
		bamIndexFile       - path/name of the BAM index file

Usage

./bam readIndexedBam <inputFilename> <outputFile.sam/bam> <bamIndexFile>

Return Value

  • 0

filter

The filter option on the bam executable filters the reads in a a SAM/BAM file. This option is documented at: Bam Executable: Filter

readReference

The readReference option on the bam executable prints the specified region of the reference sequence in an easy to read format.

Parameters

    Required Parameters:
        --refFile  : the reference
        --refName  : the SAM/BAM reference Name to read
        --start    : inclusive 0-based start position (defaults to -1)
    Required Length Parameter (one but not both needs to be specified):
        --end      : exclusive 0-based end position (defaults to -1: meaning til the end of the reference)
        --numBases : number of bases from start to display
        --params   : print the parameter settings

Usage

./bam readReference --refFile <referenceFilename> --refName <reference Name> --start <0 based start> --end <0 based end>|--numBases <number of bases> [--params]

Return Value

  • 0: the reference file was successfully read.
  • non-0: the reference file was not successfully read.

Example Output


open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.
GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA