
From Genome Analysis Wiki
Revision as of 20:33, 17 November 2010 by Upugema (talk | contribs)
Jump to: navigation, search

>= bam Executable = When statgen is compiled, the SAM/BAM executable, "bam" is generated in the statgen/src/bin/ directory.

The software reads the beginning of an input file to determine if it is SAM/BAM. To determine the format (SAM/BAM) of the output file, the software checks the output file's extension. If the extension is ".bam" it writes a BAM file, otherwise it writes a SAM file.

The bam executable has the following functions.

This executable is built using StatGenLibrary: BAM.

Just running ./bam will print the Usage information for the bam executable.


The <code>validate</code> option on the bam executable reads and validates a SAM/BAM file. This option is documented at: BamValidator


The <code>convert</code> option on the bam executable reads a SAM/BAM file and writes it as a SAM/BAM file.

The executable converts the input file into the format of the output file. So if you want to convert a BAM file to a SAM file, from the pipeline/bam/ directory you just call:

./bam --in <bamFile>.bam --out <newSamFile>.sam

Don't forget to put in the paths to the executable and your test files.



   Required Parameters:
       --in       : the SAM/BAM file to be read
       --out      : the SAM/BAM file to be written
   Optional Parameters:
       --noeof    : do not expect an EOF block on a bam file.
       --params   : print the parameter settings



./bam convert --in <inputFile> --out <outputFile.sam/bam/ubam (ubam is uncompressed bam)> [--noeof] [--params]

Return Value

Returns the SamStatus for the reads/writes.

Example Output

<pre> Number of records read = 10 Number of records written = 10 </pre>


The <code>dumpHeader</code> option on the bam executable prints the header of the specified SAM/BAM file to cout.



   Required Parameters:

filename : the sam/bam filename whose header should be printed. </pre>


./bam dumpHeader <inputFile>

Return Value

  • 0: the header was successfully read and printed.
  • non-0: the header was not successfully read or was not printed. (Returns the SamStatus.)

Example Output

<pre> @SQ SN:1 LN:247249719 @SQ SN:2 LN:242951149 @SQ SN:3 LN:199501827 </pre>


The <code>splitChromosome</code> option on the bam executable splits an indexed BAM file into multiple files based on the Chromosome (Reference Name).

The files all have the same base name, but with an _# where # corresponds with the associated reference id from the BAM file.



   Required Parameters:
       --in       : the BAM file to be split
       --out      : the base filename for the SAM/BAM files to write into.  Does not include the extension.
                    _N will be appended to the basename where N indicates the Chromosome.
   Optional Parameters:
       --noeof  : do not expect an EOF block on a bam file.
       --bamIndex : the path/name of the bam index file
                    (if not specified, uses the --in value + ".bai")
       --bamout : write the output files in BAM format (default).
       --samout : write the output files in SAM format.
       --params : print the parameter settings



./bam splitChromosome --in <inputFilename>  --out <outputFileBaseName> [--bamIndex <bamIndexFile>] [--noeof] [--bamout|--samout] [--params]

Return Value

  • 0: all records are successfully read and written.
  • non-0: at least one record was not successfully read or written.

Example Output

<pre> Reference ID -1 has 2 records Reference ID 0 has 5 records Reference ID 1 has 2 records Reference ID 2 has 1 records Reference ID 3 has 0 records Reference ID 4 has 0 records Reference ID 5 has 0 records Reference ID 6 has 0 records Reference ID 7 has 0 records Reference ID 8 has 0 records Reference ID 9 has 0 records Reference ID 10 has 0 records Reference ID 11 has 0 records Reference ID 12 has 0 records Reference ID 13 has 0 records Reference ID 14 has 0 records Reference ID 15 has 0 records Reference ID 16 has 0 records Reference ID 17 has 0 records Reference ID 18 has 0 records Reference ID 19 has 0 records Reference ID 20 has 0 records Reference ID 21 has 0 records Reference ID 22 has 0 records Number of records = 10 Returning: 0 (SUCCESS) </pre>


The <code>writeRegion</code> option on the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position).



   Required Parameters:
       --in       : the BAM file to be read
       --out      : the SAM/BAM file to write to
   Optional Parameters:
       --noeof  : do not expect an EOF block on a bam file.
       --bamIndex : the path/name of the bam index file
                    (if not specified, uses the --in value + ".bai")
       --refName  : the BAM reference Name to read (either this or refID can be specified)
       --refID    : the BAM reference ID to read (defaults to -1: unmapped)
       --start    : inclusive 0-based start position (defaults to -1)
       --end      : exclusive 0-based end position (defaults to -1: meaning til the end of the reference)
       --params   : print the parameter settings



./bam writeRegion --in <inputFilename>  --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] [--params]

Return Value

  • 0: all records are successfully read and written.
  • non-0: at least one record was not successfully read or written.

Example Output


Wrote t.sam with 2 records. </pre>


The <code>dumpRefInfo</code> option on the bam executable prints the SAM/BAM file's reference information.



   Required Parameters:
       --in               : the SAM/BAM file to be read
   Optional Parameters:
       --noeof            : do not expect an EOF block on a bam file.
       --printRecordRefs  : print the reference information for the records in the file (grouped by reference).
       --params           : print the parameter settings



./bam dumpRefInfo --in <inputFilename> [--noeof] [--printRecordRefs] [--params]

Return Value

  • 0: the file was processed successfully.
  • non-0: the file was not processed successfully.


The <code>dumpIndex</code> option on the bam executable prints BAM index file in an easy to read format.



   Required Parameters:
       --bamIndex : the path/name of the bam index file to display
   Optional Parameters:
       --refID    : the reference ID to read, defaults to print all
       --summary  : only print a summary - 1 line per reference.
       --params   : print the parameter settings



./bam dumpIndex --bamIndex <bamIndexFile> [--refID <ref#>] [--summary] [--params]

Return Value

  • 0: the BAM index file was processed successfully.
  • non-0: the BAM index file was not processed successfully.


The <code>readIndexedBam</code> option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and writes it out as a SAM/BAM file.


<pre> Required Parameters: inputFilename - path/name of the input BAM file outputFile.sam/bam - path/name of the output file bamIndexFile - path/name of the BAM index file </pre>


./bam readIndexedBam <inputFilename> <outputFile.sam/bam> <bamIndexFile>

Return Value

  • 0


The <code>filter</code> option on the bam executable filters the reads in a a SAM/BAM file. This option is documented at: Bam Executable: Filter


The <code>readReference</code> option on the bam executable prints the specified region of the reference sequence in an easy to read format.



   Required Parameters:
       --refFile  : the reference
       --refName  : the SAM/BAM reference Name to read
       --start    : inclusive 0-based start position (defaults to -1)
   Required Length Parameter (one but not both needs to be specified):
       --end      : exclusive 0-based end position (defaults to -1: meaning til the end of the reference)
       --numBases : number of bases from start to display
       --params   : print the parameter settings



./bam readReference --refFile <referenceFilename> --refName <reference Name> --start <0 based start> --end <0 based end>|--numBases <number of bases> [--params]

Return Value

  • 0: the reference file was successfully read.
  • non-0: the reference file was not successfully read.

Example Output


open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done. GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA </pre>