Difference between revisions of "C++ Class: CigarRoller"

From Genome Analysis Wiki
Jump to navigationJump to search
 
(26 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 +
[[Category:C++]]
 +
[[Category:libStatGen]]
 +
[[Category:libStatGen general]]
 +
 +
= Cigar=
 +
This class is part of [[libStatGen: general]].
 +
 +
The purpose of this class is to provide utilities for processing CIGARs.  It has read-only operators that do not allow modification to the class other than for lazy-evaluation.
 +
 +
See: http://csg.sph.umich.edu//mktrost/doxygen/current/classCigar.html for documentation.
 +
 +
The static methods are helpful for determining information about the operator.
 +
 +
See [[C++ Class: CigarRoller#Mapping Between Reference and Read/Query|Mapping Between Reference and Read/Query]] for a more detailed explanation with examples as to how the mapping between the read/query works.
 +
 +
See [[C++ Class: CigarRoller#Determining the Number of Reference and Read/Query Overlaps|Determining the Number of Reference and Read/Query Overlaps]] for a more detailed explanation with examples as to how determining overlaps works.
 +
 
= CigarRoller=
 
= CigarRoller=
This class is part of [[C++ Library: libcsg|libcsg]].
+
This class is part of [[libStatGen: general]].
 +
 
 +
The purpose of this class is to provide accessors for setting, updating, modifying the CIGAR object.  It is a child class of Cigar.
 +
 
 +
See: http://csg.sph.umich.edu//mktrost/doxygen/current/classCigarRoller.html for documentation.
 +
 
 +
= Mapping Between Reference and Read/Query =
 +
<code>int32_t Cigar::getRefOffset(int32_t queryIndex)</code> and <code>int32_t Cigar::getQueryIndex(int32_t refOffset)</code> are used to map between the reference and the read.
 +
 
 +
The queryIndex is the index in the read - from 0 to (read length - 1).
 +
The refOffset is the offset into the reference from the starting position of the read.
 +
 
 +
For Example:
 +
Reference: ACTGAACCTTGGAAACTGCCGGGGACT
 +
Read: ACTGACTGAAACCATT
 +
CIGAR: 4M10N4M3I2M4D3M
 +
POS: 5
  
This purpose of this class is to provide utilities for creating and processing CIGAR strings.
+
This means it aligns:
 +
Reference: ACTGAACCTTGGAAACTG  CCGGGGACT
 +
Read:      ACTG          ACTGAAACC    ATT
  
== Public Methods ==
+
Adding the position:
{| style="margin: 1em 1em 1em 0; background-color: #f9f9f9; border: 1px #aaa solid; border-collapse: collapse;" border="1"
+
RefPos:     5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
|-style="background: #f2f2f2; text-align: center;"
+
Reference: A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G          C  C  G  G  G  G  A  C  T
! Method Name !! Description
+
  Read:       A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T
|-
 
| <code>CigarRoller::CigarRoller()</code>
 
| Default constructor initializes as a CIGAR with no operations.
 
|}
 
  
 +
Adding the offsets:
 +
RefPos:    5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
 +
refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17          18 19 20 21 22 23 24 25 26
 +
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G          C  C  G  G  G  G  A  C  T
 +
Read:      A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T
 +
queryIndex: 0  1  2  3                                4  5  6  7  8  9 10 11 12            13 14 15
  
== Overloaded Streaming Operators ==
+
The results of a call to getRefOffset for each value passed in (where NA stands for INDEX_NA):
{| style="margin: 1em 1em 1em 0; background-color: #f9f9f9; border: 1px #aaa solid; border-collapse: collapse;" border="1"
+
queryIndex: 0 2  3  4  5  6  7  8  9 10 11 12 13 14 15 16(and any value over 16)
|-style="background: #f2f2f2; text-align: center;"
+
Return:    0  1  2  3 14 15 16 17 NA NA NA 18 19 24 25 26 NA
! Method Name !! Description
 
|-
 
| <code> std::ostream &operator << (std::ostream &stream, const CigarRoller& roller)</code>
 
| Writes all of the cigar operations contained in this roller to the passed in stream.
 
|}
 
  
 +
The results of a call to getQueryIndex for each value passed in (where NA stands for INDEX_NA):
 +
refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27(and any value over 27)
 +
Return:    0  1  2  3 NA NA NA NA NA NA NA NA NA NA  4  5  6  7 11 12 NA NA NA NA 13 14 15 NA
  
 +
The results of a call to getRefPosition passing in start position 5 (where NA stands for INDEX_NA):
 +
queryIndex: 0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16(and any value over 16)
 +
Return:    5  6  7  8 19 20 21 22 NA NA NA 23 24 29 30 31 NA
  
== Public Enums ==
+
The results of a call to getQueryIndex using refPosition and start position 5 (where NA stands for INDEX_NA):
{| style="margin: 1em 1em 1em 0; background-color: #f9f9f9; border: 1px #aaa solid; border-collapse: collapse;" border="1"
+
refPosition:5  6  7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32(and any value over 32)
|-style="background: #f2f2f2; text-align: center;"
+
  Return:    0  1  2  3 NA NA NA NA NA NA NA NA NA NA  4  5  6  7 11 12 NA NA NA NA 13 14 15 NA
! colspan="2"| enum SPACE_TYPE
 
|-
 
! Enum Value !! Description
 
|-
 
| none
 
| No operation has been specified
 
|-
 
| match
 
| The query sequence and the reference sequence bases are the same for the bases associated with this cigar operation.
 
Both <code>match</code> and <code>mismatch</code> are associated with CIGAR Operation "M"
 
|-
 
| mismatch
 
| The query sequence and the reference sequence bases are different for the bases associated with this cigar operation, but bases exist in both the query and the reference.
 
Both <code>match</code> and <code>mismatch</code> are associated with CIGAR Operation "M"
 
|-
 
| insert
 
| Insertion to the reference (the query sequence contains bases that have no corresponding base in the reference).
 
Associated with CIGAR Operation "I"
 
|-
 
| del
 
|Deletion from the reference (the reference contains bases that have no corresponding base in the query sequence).
 
Associated with CIGAR Operation "D"
 
|-
 
| skip
 
| Skipped region from the reference (the reference contains bases that have no corresponding base in the query sequence).
 
Associated with CIGAR Operation "N"
 
|-
 
| softClip
 
| Soft clip on the read (clipped sequence present in the query sequence)
 
Associated with CIGAR Operation "S"
 
|-
 
| hardClip
 
| Hard clip on the read (clipped sequence not present in the query sequence)
 
Associated with CIGAR Operation "H"
 
|-
 
|pad
 
| Padding (silent deletion from the padded reference sequence)
 
Associated with CIGAR Operation "P"
 
|}
 
  
  
== Public Constants ==
+
== Determining the Number of Reference and Read/Query Overlaps ==
{| style="margin: 1em 1em 1em 0; background-color: #f9f9f9; border: 1px #aaa solid; border-collapse: collapse;" border="1"
 
|-style="background: #f2f2f2; text-align: center;"
 
! Constant !! Value !! Description
 
|-
 
| INDEX_NA
 
| -1
 
| Value associated with an index that is not applicable/does not exist.
 
Used for converting between query and reference indexes/offsets when an associated index/offset does not exist.
 
|}
 
  
 +
A useful concept is determining the number of bases that overlap between the reference and the read in a given region.
  
== Nested Class ==
+
To do this, use <code>getNumOverlaps</code>, passing in the reference start and end positions for the region as well as the reference position where the read begins.  start is inclusive, while end is exclusive.
  
=== CigarOperation ===
+
Using the above example:
 +
RefPos:    5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
 +
refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17          18 19 20 21 22 23 24 25 26
 +
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G          C  C  G  G  G  G  A  C  T
 +
Read:      A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T
 +
queryIndex: 0  1  2  3                                4  5  6  7  8  9 10 11 12            13 14 15
  
==== Public Methods ====
+
getNumOverlaps(5,32,5) = 13 - [5, 32) covers the whole read - 13 cigar positions are "M" (found in both the reference and the read)
{| style="margin: 1em 1em 1em 0; background-color: #f9f9f9; border: 1px #aaa solid; border-collapse: collapse;" border="1"
+
getNumOverlaps(5,31,5) = 12 - skips the last overlapping position
|-style="background: #f2f2f2; text-align: center;"
+
  getNumOverlaps(0,100,5) = 13 - covers the whole read.
! Method Name !! Description
+
getNumOverlaps(-1, -1,5) = 13 - covers the whole read.
|-
+
getNumOverlaps(-1,10,5) = 4
| <code>CigarOperator::CigarOperator(Operation operation, uint32_t count)</code>
+
getNumOverlaps(10,-1,5) = 9
| Set the cigar operator with the specified operation and count length.
+
getNumOverlaps(9,19,5) = 0 - all skipped
|-
+
getNumOverlaps(9,20,5) = 1
| <code>char CigarOperator::getChar()</code>
+
getNumOverlaps(9,6,5) = 0 - start is before end
| Returns the character code (M, I, D, N, S, H, or P) associated with this operation.
+
getNumOverlaps(0,5,5) = 0 - outside of read
|-
+
getNumOverlaps(32,40,5) = 0 - outside of read
| <code>bool CigarOperator::operator == (CigarOperator &rhs)</code>
+
getNumOverlaps(0,5,1) = 4 - with a different start position, this range overlaps the read with 4 bases
| Returns true if the passed in operator is the same as this operator, false if not.
+
getNumOverlaps(32,40,32) = 4 - with a different start position, this range overlaps the read with 4 bases
|-
 
| <code>bool CigarOperator::operator != (CigarOperator &rhs)</code>
 
| Returns true if the passed in operator is not the same as this operator, false if they are the same.
 
|}
 

Latest revision as of 12:00, 2 February 2017


Cigar

This class is part of libStatGen: general.

The purpose of this class is to provide utilities for processing CIGARs. It has read-only operators that do not allow modification to the class other than for lazy-evaluation.

See: http://csg.sph.umich.edu//mktrost/doxygen/current/classCigar.html for documentation.

The static methods are helpful for determining information about the operator.

See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how the mapping between the read/query works.

See Determining the Number of Reference and Read/Query Overlaps for a more detailed explanation with examples as to how determining overlaps works.

CigarRoller

This class is part of libStatGen: general.

The purpose of this class is to provide accessors for setting, updating, modifying the CIGAR object. It is a child class of Cigar.

See: http://csg.sph.umich.edu//mktrost/doxygen/current/classCigarRoller.html for documentation.

Mapping Between Reference and Read/Query

int32_t Cigar::getRefOffset(int32_t queryIndex) and int32_t Cigar::getQueryIndex(int32_t refOffset) are used to map between the reference and the read.

The queryIndex is the index in the read - from 0 to (read length - 1). The refOffset is the offset into the reference from the starting position of the read.

For Example:

Reference: ACTGAACCTTGGAAACTGCCGGGGACT
Read: ACTGACTGAAACCATT
CIGAR: 4M10N4M3I2M4D3M
POS: 5

This means it aligns:

Reference: ACTGAACCTTGGAAACTG   CCGGGGACT
Read:      ACTG          ACTGAAACC    ATT

Adding the position:

RefPos:     5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G           C  C  G  G  G  G  A  C  T
Read:       A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T

Adding the offsets:

RefPos:     5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17          18 19 20 21 22 23 24 25 26
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G           C  C  G  G  G  G  A  C  T
Read:       A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T
queryIndex: 0  1  2  3                                4  5  6  7  8  9 10 11 12             13 14 15

The results of a call to getRefOffset for each value passed in (where NA stands for INDEX_NA):

queryIndex: 0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16(and any value over 16)
Return:     0  1  2  3 14 15 16 17 NA NA NA 18 19 24 25 26 NA

The results of a call to getQueryIndex for each value passed in (where NA stands for INDEX_NA):

refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27(and any value over 27)
Return:     0  1  2  3 NA NA NA NA NA NA NA NA NA NA  4  5  6  7 11 12 NA NA NA NA 13 14 15 NA

The results of a call to getRefPosition passing in start position 5 (where NA stands for INDEX_NA):

queryIndex: 0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16(and any value over 16)
Return:     5  6  7  8 19 20 21 22 NA NA NA 23 24 29 30 31 NA

The results of a call to getQueryIndex using refPosition and start position 5 (where NA stands for INDEX_NA):

refPosition:5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32(and any value over 32)
Return:     0  1  2  3 NA NA NA NA NA NA NA NA NA NA  4  5  6  7 11 12 NA NA NA NA 13 14 15 NA


Determining the Number of Reference and Read/Query Overlaps

A useful concept is determining the number of bases that overlap between the reference and the read in a given region.

To do this, use getNumOverlaps, passing in the reference start and end positions for the region as well as the reference position where the read begins. start is inclusive, while end is exclusive.

Using the above example:

RefPos:     5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17          18 19 20 21 22 23 24 25 26
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G           C  C  G  G  G  G  A  C  T
Read:       A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T
queryIndex: 0  1  2  3                                4  5  6  7  8  9 10 11 12             13 14 15
getNumOverlaps(5,32,5) = 13 - [5, 32) covers the whole read - 13 cigar positions are "M" (found in both the reference and the read)
getNumOverlaps(5,31,5) = 12 - skips the last overlapping position
getNumOverlaps(0,100,5) = 13 - covers the whole read.
getNumOverlaps(-1, -1,5) = 13 - covers the whole read.
getNumOverlaps(-1,10,5) = 4
getNumOverlaps(10,-1,5) = 9
getNumOverlaps(9,19,5) = 0 - all skipped
getNumOverlaps(9,20,5) = 1
getNumOverlaps(9,6,5) = 0 - start is before end
getNumOverlaps(0,5,5) = 0 - outside of read
getNumOverlaps(32,40,5) = 0 - outside of read
getNumOverlaps(0,5,1) = 4 - with a different start position, this range overlaps the read with 4 bases
getNumOverlaps(32,40,32) = 4 - with a different start position, this range overlaps the read with 4 bases