Difference between revisions of "C++ Class: CigarRoller"
Line 257: | Line 257: | ||
getNumOverlaps(0,5,5) = 0 - outside of read | getNumOverlaps(0,5,5) = 0 - outside of read | ||
getNumOverlaps(32,40,5) = 0 - outside of read | getNumOverlaps(32,40,5) = 0 - outside of read | ||
+ | getNumOverlaps(0,5,1) = 4 - with a different start position, this range overlaps the read with 4 bases | ||
+ | getNumOverlaps(32,40,32) = 4 - with a different start position, this range overlaps the read with 4 bases |
Revision as of 16:39, 3 August 2010
Contents
CigarRoller
This class is part of libcsg.
This purpose of this class is to provide utilities for creating and processing CIGAR strings.
Public Methods
Method Name | Description |
---|---|
CigarRoller::CigarRoller()
|
Default constructor initializes as a CIGAR with no operations. |
CigarRoller::CigarRoller(const char *cigarString)
|
Constructor that initializes the object with the specified cigarString. |
CigarRoller & CigarRoller::operator += (CigarRoller &rhs)
|
Add the contents of the specified CigarRoller to this object. |
CigarRoller & CigarRoller::operator += (CigarOperator &rhs)
|
Append the specified cigar operation to this object. |
void CigarRoller::Add(Operation operation, int count)
|
Adds the specified operation with the specified count to this object. |
void CigarRoller::Add(const char *cigarString)
|
Adds the specified cigarString to this object. |
void CigarRoller::Set(const char *cigarString)
|
Sets this object to the specified cigarString. |
DEPRECATED int CigarRoller::getMatchPositionOffset()
|
DO NOT USE. |
const char * CigarRoller::getString()
|
Returns the string representation of this CIGAR object. |
void CigarRoller::getExpandedString(std::string &s)
|
Sets the specified string to a string of characters that represent this cigar with no digits (a CIGAR of "3M" would return "MMM") |
void CigarRoller::clear()
|
Clear this object so that it has 0 Cigar Operations. |
CigarOperator & CigarRoller::operator [] (int i)
|
Return the Cigar Operation at the specified index (starting at 0). |
bool CigarRoller::operator == (CigarRoller &rhs)
|
Returns true if two Cigar Rollers are the same (the same operations of the same sizes) |
int CigarRoller::size()
|
Return the number of cigar operations in this object. |
void CigarRoller::Dump()
|
Write this object as a string to cout. |
int CigarRoller::getExpectedQueryBaseCount()
|
Returns the expected read length |
int CigarRoller::getExpectedReferenceBaseCount()
|
Return how many bases in the reference are spanned by the given CIGAR string |
int32_t CigarRoller::getRefOffset(int32_t queryIndex)
|
Return the reference offset associated with the specified query index or INDEX_NA based on this cigar.
See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
int32_t CigarRoller::getQueryIndex(int32_t refOffset)
|
Return the query index associated with the specified reference offset or INDEX_NA based on this cigar.
See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
int32_t CigarRoller::getRefPosition(int32_t queryIndex, int32_t queryStartPos)
|
Return the reference position associated with the specified query index or INDEX_NA based on this cigar and the specified queryStartPos.
queryStartPops is the leftmost mapping position of the first matching base in the query. See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
int32_t CigarRoller::getQueryIndex(int32_t refPosition, int32_t queryStartPos)
|
Return the query index associated with the specified reference position and queryStartPos or INDEX_NA based on this cigar.
queryStartPops is the leftmost mapping position of the first matching base in the query. See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
uint32_t getNumOverlaps(int32_t start, int32_t end, int32_t queryStartPos)
|
Return the number of bases that overlap the reference and the read associated with this cigar that falls within the specified region.
start : inclusive start position (reference position) of the region to check for overlaps in. (-1 indicates to start at the beginning of the reference.) end : exclusive end position (reference position) of the region to check for overlaps in. (-1 indicates to go to the end of the reference.) queryStartPos : leftmost mapping position of the first matching base in the query. NOTE: ensure that start, end, and queryStartPos are all in the same base (0 or 1). See Determining the Number of Reference and Read/Query Overlaps for a more detailed explanation with examples as to how it works. |
Overloaded Streaming Operators
Method Name | Description |
---|---|
std::ostream &operator << (std::ostream &stream, const CigarRoller& roller)
|
Writes all of the cigar operations contained in this roller to the passed in stream. |
std::ostream &operator << (std::ostream &stream, const CigarRoller::CigarOperator& o)
|
Writes the specified cigar operation to the specified stream as <count><char> (3M). |
Public Enums
enum SPACE_TYPE | |
---|---|
Enum Value | Description |
none | No operation has been specified |
match | The query sequence and the reference sequence bases are the same for the bases associated with this cigar operation.
Both |
mismatch | The query sequence and the reference sequence bases are different for the bases associated with this cigar operation, but bases exist in both the query and the reference.
Both |
insert | Insertion to the reference (the query sequence contains bases that have no corresponding base in the reference).
Associated with CIGAR Operation "I" |
del | Deletion from the reference (the reference contains bases that have no corresponding base in the query sequence).
Associated with CIGAR Operation "D" |
skip | Skipped region from the reference (the reference contains bases that have no corresponding base in the query sequence).
Associated with CIGAR Operation "N" |
softClip | Soft clip on the read (clipped sequence present in the query sequence)
Associated with CIGAR Operation "S" |
hardClip | Hard clip on the read (clipped sequence not present in the query sequence)
Associated with CIGAR Operation "H" |
pad | Padding (silent deletion from the padded reference sequence)
Associated with CIGAR Operation "P" |
Public Constants
Constant | Value | Description |
---|---|---|
INDEX_NA | -1 | Value associated with an index that is not applicable/does not exist.
Used for converting between query and reference indexes/offsets when an associated index/offset does not exist. |
Nested Class
CigarOperation
Public Methods
Method Name | Description |
---|---|
CigarOperator::CigarOperator(Operation operation, uint32_t count)
|
Set the cigar operator with the specified operation and count length. |
char CigarOperator::getChar()
|
Returns the character code (M, I, D, N, S, H, or P) associated with this operation. |
bool CigarOperator::operator == (CigarOperator &rhs)
|
Returns true if the passed in operator is the same as this operator, false if not. |
bool CigarOperator::operator != (CigarOperator &rhs)
|
Returns true if the passed in operator is not the same as this operator, false if they are the same. |
Mapping Between Reference and Read/Query
int32_t CigarRoller::getRefOffset(int32_t queryIndex)
and int32_t CigarRoller::getQueryIndex(int32_t refOffset)
are used to map between the reference and the read.
The queryIndex is the index in the read - from 0 to (read length - 1). The refOffset is the offset into the reference from the starting position of the read.
For Example:
Reference: ACTGAACCTTGGAAACTGCCGGGGACT Read: ACTGACTGAAACCATT CIGAR: 4M10N4M3I2M4D3M POS: 5
This means it aligns:
Reference: ACTGAACCTTGGAAACTG CCGGGGACT Read: ACTG ACTGAAACC ATT
Adding the position:
RefPos: 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Reference: A C T G A A C C T T G G A A A C T G C C G G G G A C T Read: A C T G A C T G A A A C C A T T
Adding the offsets:
RefPos: 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 refOffset: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Reference: A C T G A A C C T T G G A A A C T G C C G G G G A C T Read: A C T G A C T G A A A C C A T T queryIndex: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
The results of a call to getRefOffset for each value passed in (where NA stands for INDEX_NA):
queryIndex: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16(and any value over 16) Return: 0 1 2 3 14 15 16 17 NA NA NA 18 19 24 25 26 NA
The results of a call to getQueryIndex for each value passed in (where NA stands for INDEX_NA):
refOffset: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27(and any value over 27) Return: 0 1 2 3 NA NA NA NA NA NA NA NA NA NA 4 5 6 7 11 12 NA NA NA NA 13 14 15 NA
The results of a call to getRefPosition passing in start position 5 (where NA stands for INDEX_NA):
queryIndex: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16(and any value over 16) Return: 5 6 7 8 19 20 21 22 NA NA NA 23 24 29 30 31 NA
The results of a call to getQueryIndex using refPosition and start position 5 (where NA stands for INDEX_NA):
refPosition:5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32(and any value over 32) Return: 0 1 2 3 NA NA NA NA NA NA NA NA NA NA 4 5 6 7 11 12 NA NA NA NA 13 14 15 NA
Determining the Number of Reference and Read/Query Overlaps
A useful concept is determining the number of bases that overlap between the reference and the read in a given region.
To do this, use getNumOverlaps
, passing in the reference start and end positions for the region as well as the reference position where the read begins. start is inclusive, while end is exclusive.
Using the above example:
RefPos: 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 refOffset: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Reference: A C T G A A C C T T G G A A A C T G C C G G G G A C T Read: A C T G A C T G A A A C C A T T queryIndex: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
getNumOverlaps(5,32,5) = 13 - [5, 32) covers the whole read - 13 cigar positions are "M" (found in both the reference and the read) getNumOverlaps(5,31,5) = 12 - skips the last overlapping position getNumOverlaps(0,100,5) = 13 - covers the whole read. getNumOverlaps(-1, -1,5) = 13 - covers the whole read. getNumOverlaps(-1,10,5) = 4 getNumOverlaps(10,-1,5) = 9 getNumOverlaps(9,19,5) = 0 - all skipped getNumOverlaps(9,20,5) = 1 getNumOverlaps(9,6,5) = 0 - start is before end getNumOverlaps(0,5,5) = 0 - outside of read getNumOverlaps(32,40,5) = 0 - outside of read getNumOverlaps(0,5,1) = 4 - with a different start position, this range overlaps the read with 4 bases getNumOverlaps(32,40,32) = 4 - with a different start position, this range overlaps the read with 4 bases