C++ Class: CigarRoller
CigarRoller
This class is part of libcsg.
This purpose of this class is to provide utilities for creating and processing CIGAR strings.
Public Methods
Method Name | Description |
---|---|
CigarRoller::CigarRoller()
|
Default constructor initializes as a CIGAR with no operations. |
CigarRoller::CigarRoller(const char *cigarString)
|
Constructor that initializes the object with the specified cigarString. |
CigarRoller & CigarRoller::operator += (CigarRoller &rhs)
|
Add the contents of the specified CigarRoller to this object. |
CigarRoller & CigarRoller::operator += (CigarOperator &rhs)
|
Append the specified cigar operation to this object. |
void CigarRoller::Add(Operation operation, int count)
|
Adds the specified operation with the specified count to this object. |
void CigarRoller::Add(const char *cigarString)
|
Adds the specified cigarString to this object. |
void CigarRoller::Set(const char *cigarString)
|
Sets this object to the specified cigarString. |
DEPRECATED int CigarRoller::getMatchPositionOffset()
|
DO NOT USE. |
const char * CigarRoller::getString()
|
Returns the string representation of this CIGAR object. |
void CigarRoller::getExpandedString(std::string &s)
|
Sets the specified string to a string of characters that represent this cigar with no digits (a CIGAR of "3M" would return "MMM") |
void CigarRoller::clear()
|
Clear this object so that it has 0 Cigar Operations. |
CigarOperator & CigarRoller::operator [] (int i)
|
Return the Cigar Operation at the specified index (starting at 0). |
bool CigarRoller::operator == (CigarRoller &rhs)
|
Returns true if two Cigar Rollers are the same (the same operations of the same sizes) |
int CigarRoller::size()
|
Return the number of cigar operations in this object. |
void CigarRoller::Dump()
|
Write this object as a string to cout. |
int CigarRoller::getExpectedQueryBaseCount()
|
Returns the expected read length |
int CigarRoller::getExpectedReferenceBaseCount()
|
Return how many bases in the reference are spanned by the given CIGAR string |
int32_t CigarRoller::getRefOffset(int32_t queryIndex)
|
Return the reference offset associated with the specified query index or INDEX_NA based on this cigar.
See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
int32_t CigarRoller::getQueryIndex(int32_t refOffset)
|
Return the query index associated with the specified reference offset or INDEX_NA based on this cigar.
See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
int32_t CigarRoller::getRefPosition(int32_t queryIndex, int32_t queryStartPos)
|
Return the reference position associated with the specified query index or INDEX_NA based on this cigar and the specified queryStartPos.
queryStartPops is the leftmost mapping position of the first matching base in the query. See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
int32_t CigarRoller::getQueryIndex(int32_t refPosition, int32_t queryStartPos)
|
Return the query index associated with the specified reference position and queryStartPos or INDEX_NA based on this cigar.
queryStartPops is the leftmost mapping position of the first matching base in the query. See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how it works. |
uint32_t getNumOverlaps(int32_t start, int32_t end, int32_t queryStartPos)
|
Return the number of bases that overlap the reference and the read associated with this cigar that falls within the specified region.
start : inclusive start position (reference position) of the region to check for overlaps in. (-1 indicates to start at the beginning of the reference.) end : exclusive end position (reference position) of the region to check for overlaps in. (-1 indicates to go to the end of the reference.) queryStartPos : leftmost mapping position of the first matching base in the query. NOTE: ensure that start, end, and queryStartPos are all in the same base (0 or 1). See Determining the Number of Reference and Read/Query Overlaps for a more detailed explanation with examples as to how it works. |
Overloaded Streaming Operators
Method Name | Description |
---|---|
std::ostream &operator << (std::ostream &stream, const CigarRoller& roller)
|
Writes all of the cigar operations contained in this roller to the passed in stream. |
std::ostream &operator << (std::ostream &stream, const CigarRoller::CigarOperator& o)
|
Writes the specified cigar operation to the specified stream as <count><char> (3M). |
Public Enums
enum SPACE_TYPE | |
---|---|
Enum Value | Description |
none | No operation has been specified |
match | The query sequence and the reference sequence bases are the same for the bases associated with this cigar operation.
Both |
mismatch | The query sequence and the reference sequence bases are different for the bases associated with this cigar operation, but bases exist in both the query and the reference.
Both |
insert | Insertion to the reference (the query sequence contains bases that have no corresponding base in the reference).
Associated with CIGAR Operation "I" |
del | Deletion from the reference (the reference contains bases that have no corresponding base in the query sequence).
Associated with CIGAR Operation "D" |
skip | Skipped region from the reference (the reference contains bases that have no corresponding base in the query sequence).
Associated with CIGAR Operation "N" |
softClip | Soft clip on the read (clipped sequence present in the query sequence)
Associated with CIGAR Operation "S" |
hardClip | Hard clip on the read (clipped sequence not present in the query sequence)
Associated with CIGAR Operation "H" |
pad | Padding (silent deletion from the padded reference sequence)
Associated with CIGAR Operation "P" |
Public Constants
Constant | Value | Description |
---|---|---|
INDEX_NA | -1 | Value associated with an index that is not applicable/does not exist.
Used for converting between query and reference indexes/offsets when an associated index/offset does not exist. |
Nested Class
CigarOperation
Public Methods
Method Name | Description |
---|---|
CigarOperator::CigarOperator(Operation operation, uint32_t count)
|
Set the cigar operator with the specified operation and count length. |
char CigarOperator::getChar()
|
Returns the character code (M, I, D, N, S, H, or P) associated with this operation. |
bool CigarOperator::operator == (CigarOperator &rhs)
|
Returns true if the passed in operator is the same as this operator, false if not. |
bool CigarOperator::operator != (CigarOperator &rhs)
|
Returns true if the passed in operator is not the same as this operator, false if they are the same. |
Mapping Between Reference and Read/Query
int32_t CigarRoller::getRefOffset(int32_t queryIndex)
and int32_t CigarRoller::getQueryIndex(int32_t refOffset)
are used to map between the reference and the read.
The queryIndex is the index in the read - from 0 to (read length - 1). The refOffset is the offset into the reference from the starting position of the read.
For Example:
Reference: ACTGAACCTTGGAAACTGCCGGGGACT Read: ACTGACTGAAACCACT CIGAR: 4M10N4M3I2M4D3M POS: 5
This means it aligns:
Reference: ACTGAACCTTGGAAACTG CCGGGGACT Read: ACTG ACTGAAACC ACT
Adding the position:
RefPos: 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Reference: A C T G A A C C T T G G A A A C T G C C G G G G A C T Read: A C T G A C T G A A A C C A C T
Adding the offsets:
RefPos: 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 refOffset: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Reference: A C T G A A C C T T G G A A A C T G C C G G G G A C T Read: A C T G A C T G A A A C C A C T queryIndex: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
The results of a call to getRefOffset for each value passed in (where NA stands for INDEX_NA):
queryIndex: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16(and any value over 16) Return: 0 1 2 3 14 15 16 17 NA NA NA 18 19 24 25 26 NA
The results of a call to getQueryIndex for each value passed in (where NA stands for INDEX_NA):
refOffset: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27(and any value over 27) Return: 0 1 2 3 NA NA NA NA NA NA NA NA NA NA 4 5 6 7 11 12 NA NA NA NA 13 14 15 NA
The results of a call to getRefPosition passing in start position 5 (where NA stands for INDEX_NA):
queryIndex: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16(and any value over 16) Return: 5 6 7 8 19 20 21 22 NA NA NA 23 24 29 30 31 NA
The results of a call to getQueryIndex using refPosition and start position 5 (where NA stands for INDEX_NA):
refPosition:5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32(and any value over 32) Return: 0 1 2 3 NA NA NA NA NA NA NA NA NA NA 4 5 6 7 11 12 NA NA NA NA 13 14 15 NA