C++ Class: CigarRoller

From Genome Analysis Wiki
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.


Cigar

This class is part of libStatGen: general.

The purpose of this class is to provide utilities for processing CIGARs. It has read-only operators that do not allow modification to the class other than for lazy-evaluation.

See: http://csg.sph.umich.edu//mktrost/doxygen/current/classCigar.html for documentation.

The static methods are helpful for determining information about the operator.

See Mapping Between Reference and Read/Query for a more detailed explanation with examples as to how the mapping between the read/query works.

See Determining the Number of Reference and Read/Query Overlaps for a more detailed explanation with examples as to how determining overlaps works.

CigarRoller

This class is part of libStatGen: general.

The purpose of this class is to provide accessors for setting, updating, modifying the CIGAR object. It is a child class of Cigar.

See: http://csg.sph.umich.edu//mktrost/doxygen/current/classCigarRoller.html for documentation.

Mapping Between Reference and Read/Query

int32_t Cigar::getRefOffset(int32_t queryIndex) and int32_t Cigar::getQueryIndex(int32_t refOffset) are used to map between the reference and the read.

The queryIndex is the index in the read - from 0 to (read length - 1). The refOffset is the offset into the reference from the starting position of the read.

For Example:

Reference: ACTGAACCTTGGAAACTGCCGGGGACT
Read: ACTGACTGAAACCATT
CIGAR: 4M10N4M3I2M4D3M
POS: 5

This means it aligns:

Reference: ACTGAACCTTGGAAACTG   CCGGGGACT
Read:      ACTG          ACTGAAACC    ATT

Adding the position:

RefPos:     5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G           C  C  G  G  G  G  A  C  T
Read:       A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T

Adding the offsets:

RefPos:     5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17          18 19 20 21 22 23 24 25 26
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G           C  C  G  G  G  G  A  C  T
Read:       A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T
queryIndex: 0  1  2  3                                4  5  6  7  8  9 10 11 12             13 14 15

The results of a call to getRefOffset for each value passed in (where NA stands for INDEX_NA):

queryIndex: 0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16(and any value over 16)
Return:     0  1  2  3 14 15 16 17 NA NA NA 18 19 24 25 26 NA

The results of a call to getQueryIndex for each value passed in (where NA stands for INDEX_NA):

refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27(and any value over 27)
Return:     0  1  2  3 NA NA NA NA NA NA NA NA NA NA  4  5  6  7 11 12 NA NA NA NA 13 14 15 NA

The results of a call to getRefPosition passing in start position 5 (where NA stands for INDEX_NA):

queryIndex: 0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16(and any value over 16)
Return:     5  6  7  8 19 20 21 22 NA NA NA 23 24 29 30 31 NA

The results of a call to getQueryIndex using refPosition and start position 5 (where NA stands for INDEX_NA):

refPosition:5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32(and any value over 32)
Return:     0  1  2  3 NA NA NA NA NA NA NA NA NA NA  4  5  6  7 11 12 NA NA NA NA 13 14 15 NA


Determining the Number of Reference and Read/Query Overlaps

A useful concept is determining the number of bases that overlap between the reference and the read in a given region.

To do this, use getNumOverlaps, passing in the reference start and end positions for the region as well as the reference position where the read begins. start is inclusive, while end is exclusive.

Using the above example:

RefPos:     5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22          23 24 25 26 27 28 29 30 31
refOffset:  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17          18 19 20 21 22 23 24 25 26
Reference:  A  C  T  G  A  A  C  C  T  T  G  G  A  A  A  C  T  G           C  C  G  G  G  G  A  C  T
Read:       A  C  T  G                                A  C  T  G  A  A  A  C  C              A  T  T
queryIndex: 0  1  2  3                                4  5  6  7  8  9 10 11 12             13 14 15
getNumOverlaps(5,32,5) = 13 - [5, 32) covers the whole read - 13 cigar positions are "M" (found in both the reference and the read)
getNumOverlaps(5,31,5) = 12 - skips the last overlapping position
getNumOverlaps(0,100,5) = 13 - covers the whole read.
getNumOverlaps(-1, -1,5) = 13 - covers the whole read.
getNumOverlaps(-1,10,5) = 4
getNumOverlaps(10,-1,5) = 9
getNumOverlaps(9,19,5) = 0 - all skipped
getNumOverlaps(9,20,5) = 1
getNumOverlaps(9,6,5) = 0 - start is before end
getNumOverlaps(0,5,5) = 0 - outside of read
getNumOverlaps(32,40,5) = 0 - outside of read
getNumOverlaps(0,5,1) = 4 - with a different start position, this range overlaps the read with 4 bases
getNumOverlaps(32,40,32) = 4 - with a different start position, this range overlaps the read with 4 bases