|
|
| (2 intermediate revisions by one other user not shown) |
| Line 35: |
Line 35: |
| | == Mapping Qualities == | | == Mapping Qualities == |
| | | | |
| − | We should evaluate mapping qualities by counting how many reads are assigned each mapping quality (or greater) and among those how many map correctly or incorrectly. This gives a Heng Li graph, where one plots number of correctly mapped reads vs. number of mismapped reads. | + | We should evaluate mapping qualities by counting how many reads are assigned each mapping quality (or greater) and among those how many map correctly or incorrectly. This gives a Heng Li graph, where one plots number of correctly mapped reads vs. number of mismapped reads. |
| − | | |
| − | == Available Test Datasets ==
| |
| − | | |
| − | *Location: wonderland:~zhanxw/BigSimulation
| |
| − | *Scenarios:
| |
| − | | |
| − | no polymorphism ; 1, 2, 3 SNP ; Deletion 5, 30, 200; Insertion 5, 30
| |
| − | | |
| − | *Quality String
| |
| − | | |
| − | Picked the 75 percentile of Sanger Iluumina 108 mer test data set
| |
| − | BCCCCBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBAAAAAAAAAA@@@@@@@@@@@@@@@???????????>>>>>>>>>>>>=========<<<<<<<<<<;;";
| |
| − | | |
| − | | |
| − | *Format
| |
| − | | |
| − | ; Both base space and color space
| |
| − | ; Both single end and paired end, and paired end reads are given insert size 1500.
| |
| − | ; Forward strand and reverse strand are randomly assign with probability 1/2
| |
| − | | |
| − | * Tag
| |
| − | @2:12345:F:SE:Exact
| |
| − | @2:12345:F:SE:SNP:2,12345,A,G;2,12346,T,C
| |
| − | @2:12345:F:PE+offset:SNP:2,12345,A,G (ref is A, read is G)
| |
| − | @2:12345:F:PE+offset:Indel:25M30D5M
| |
| − | | |
| − | * File Naming
| |
| − | BS_SE_EXACT_1M_50
| |
| − | BS_SE_SNP1_1M_50
| |
| − | CS_SE_INDEL1_1M
| |
| − | CS_SE_INDEL30_1M
| |
| − | CS_SE_INDEL200_1M
| |
| − | CS_SE_DEL1_1M
| |
| − | | |
| − | For PE, appending "_1" and "_2", e.g.:
| |
| − | PE_EXACT_1M_1
| |
| − | PE_EXACT_1M_2
| |
| − | | |
| − | *Program (generator)
| |
| − | | |
| − | Usage:
| |
| − | | |
| − | generator [bs|cs] [se|pe] [exact|snpXX|indelXX|delXX] -n numbers -l readLength -i insertSize
| |
| − | exact: Accurate sample from reference genome
| |
| − | snpXX: Bring total XXX SNP for a single read or a pair of reads
| |
| − | indelXX: Insert a random XX-length piece for a single read, or at the same position for a paired reads
| |
| − | delXX: Delete a random XX-length piece for a single read, or at the same position for a paired reads
| |
| − | e.g. ./generator bs se exact -n 100 -l 35
| |
| − | | |
| − | *Output
| |
| − | | |
| − | Simulation file are named like: BS_SE_EXACT_1000000_35, meaning base space, single end, exact (no polymorphism), 1M reads, 35 bp per read. For each read, the tag was named in a similar way to Sanger's.
| |
| − | | |
| − | * Example
| |
| − | For illumina (from Sanger, 108mer hap1 test file):
| |
| − | Example:
| |
| − | <pre>
| |
| − | _1 file:
| |
| − | @20:14812275:F:217;None;None/1
| |
| − | AGTTGTTTACTTTCCTTTCCTACCTGGCTGCATCTGTCACATGCATATAGTGTCCCCTGACATGAAGCTCTGATATTGATCTGGAGCCCTATTGGTCTGCAAGTGACT
| |
| − | +
| |
| − | %27::2:::<70<<::95<<6/8<.)3;::9-,3:6/67731/.+)66;;53'31;9<815.%%%+%4-%%%90-)./26<831))(.%%%%%%%)%0%2%%%%%+%%
| |
| − | | |
| − | @15:59364621:R:-118;None;None/1
| |
| − | TGTTCAACCCACTATTAAGCCAGTATTAAATTGTTAATATCAGTTATTATACTTTTATTTCTAAAATTTCTATTTGATCCCTTTTTTTATAAACTCCAATGCATTCTC
| |
| − | +
| |
| − | %%2=;28>>>>=><>>>>>=>>=>>>;>=>9<1%+,//0+)<<91<4=;;<.%)2::8;;/9<;;;;8647<<;8;;066:<:4628;;;;5:9<<0/25752:3482
| |
| − | | |
| − | _2 file:
| |
| − | @20:14812275:F:217;None;None/2
| |
| − | CACTGGAGGGAATCCAATCCCAAATTAATATAACAAAACCAGAAGCTTGCTTAAAAAATATTTTATCAGATTCCAAAGTTGAGCTTGTGTTAGGGTGTACTGGAACTC
| |
| − | +
| |
| − | %%0;+250::-863486::599<9679/2%%))%+80%--7<;9/1%33,-%%)28/),3,67-8;56<1%)0/%%8;<;59/%%,())%%1%%+%).%099'4;+%-
| |
| − | | |
| − | @15:59364621:R:-118;None;None/2
| |
| − | AGAAATAAGACCACATGACAATGTTAAAAATAAAACAGGCAATAGCAATAGTCCCAGAGGTGGTTACAATATGATTTCATGCTCCAGAAAGTATAGGAGAAGACAAAG
| |
| − | +
| |
| − | %3===;==;7<<;7<5;==<<4<;9=8==<====:<<<<<;<==:=<58;===;:8'8:<===:.9:38908:=;;7;57)%.+%)967%%-%%'6:-%)7);<;0+%
| |
| − | </pre>
| |
| − | | |
| − | Conclusion:
| |
| − | If the first read is forward, then itself is the same as reference sequence and the second read is reverse complement to the reference sequence.
| |
| − | If the first read is backward, then itself is reverse complement to the reference genome and the second read is the same as the reference sequence.
| |
| − | The first strand always position can always obtain from tag, first two fields (seperated by colon).
| |
| − | The second strand position is first strand position plus the offset.
| |
| − | | |
| − | For SOLiD (from Sanger, 50 mer hap1 test file)
| |
| − | e.g.
| |
| − | | |
| − | <pre>
| |
| − | _1 file:
| |
| − | >2:67043752:F:1445;2,67043761,A,G;None
| |
| − | T12221203021201200302123102221322000012301300211213
| |
| − | 22212031230012003021211022213220000123013022112123 (ref)
| |
| − | >4:125830377:R:-1541;None;None
| |
| − | T30002222300330113020203010322111010300030003230320
| |
| − | | |
| − | _2 file:
| |
| − | >2:67043752:F:1445;2,67043761,A,G;None
| |
| − | G13031223023023012201210020003310110111111203310211
| |
| − | 30312230230230122012100200033121201111113033112112 (ref)
| |
| − |
| |
| − | >4:125830377:R:-1541;None;None
| |
| − | G13311131230200010201210032223330120312000301230032
| |
| − | | |
| − | </pre>
| |
| − | | |
| − | Conclusion:
| |
| − | The first strand and second strand have the same direction (both either same as the reference genome, or reverse complement to reference genome),
| |
| − | where their positions are the same as Illumina reads.
| |
| − | | |
| − | <br>
| |
| − | | |
| − | = Bulk statistics result =
| |
| − | Running time (all submitted to the MOSIX client nodes)
| |
| − | <br>
| |
| − | Calculated by "./parseRunbatch.py batch2.log |cutrange 0,-1|charrange :-1".
| |
| − | | |
| − | Log file is from runbatch.pl and negative time means unfinished (at the moment of editing).
| |
| − | | |
| − | TODO: Add file size comparison; add link to memory page summarized by Dharknes.
| |
| − | <pre>
| |
| − | BWA(second) Karma(second) Scenarios
| |
| − | 2594 7182 BS_SE_DEL200_1000000_50.fastq
| |
| − | 2641 -1 BS_SE_DEL30_1000000_50.fastq
| |
| − | 2355 -1 BS_SE_DEL5_1000000_50.fastq
| |
| − | 441 7941 BS_SE_EXACT_1000000_50.fastq
| |
| − | 809 282 BS_SE_INDEL30_1000000_50.fastq
| |
| − | 2217 -1 BS_SE_INDEL5_1000000_50.fastq
| |
| − | 645 7206 BS_SE_SNP1_1000000_50.fastq
| |
| − | 1102 -1 BS_SE_SNP2_1000000_50.fastq
| |
| − | 1142 -1 BS_SE_SNP3_1000000_50.fastq
| |
| − | 6536 8874 BS_PE_DEL200_1000000_50_?.fastq
| |
| − | 6699 9017 BS_PE_DEL30_1000000_50_?.fastq
| |
| − | 6468 9033 BS_PE_DEL5_1000000_50_?.fastq
| |
| − | 1743 10112 BS_PE_EXACT_1000000_50_?.fastq
| |
| − | 2305 231 BS_PE_INDEL30_1000000_50_?.fastq
| |
| − | 5703 2989 BS_PE_INDEL5_1000000_50_?.fastq
| |
| − | 1974 3718 BS_PE_SNP1_1000000_50_?.fastq
| |
| − | 2396 3339 BS_PE_SNP2_1000000_50_?.fastq
| |
| − | 2817 3131 BS_PE_SNP3_1000000_50_?.fastq
| |
| − | 4362 16074 CS_PE_DEL200_1000000_50_?.fastq
| |
| − | 4385 -1 CS_PE_DEL30_1000000_50_?.fastq
| |
| − | 4373 9287 CS_PE_DEL5_1000000_50_?.fastq
| |
| − | 773 -1 CS_PE_EXACT_1000000_50_?.fastq
| |
| − | 1735 3142 CS_PE_INDEL30_1000000_50_?.fastq
| |
| − | 4023 8591 CS_PE_INDEL5_1000000_50_?.fastq
| |
| − | 1034 10528 CS_PE_SNP1_1000000_50_?.fastq
| |
| − | 2236 -1 CS_PE_SNP2_1000000_50_?.fastq
| |
| − | 3810 6617 CS_PE_SNP3_1000000_50_?.fastq
| |
| − | 7129 1493 CS_SE_DEL200_1000000_50.fastq
| |
| − | 7115 1513 CS_SE_DEL30_1000000_50.fastq
| |
| − | 7065 1542 CS_SE_DEL5_1000000_50.fastq
| |
| − | 1544 1666 CS_SE_EXACT_1000000_50.fastq
| |
| − | 2954 289 CS_SE_INDEL30_1000000_50.fastq
| |
| − | 6547 1390 CS_SE_INDEL5_1000000_50.fastq
| |
| − | 1690 1661 CS_SE_SNP1_1000000_50.fastq
| |
| − | 2853 1449 CS_SE_SNP2_1000000_50.fastq
| |
| − | 4039 1237 CS_SE_SNP3_1000000_50.fastq
| |
| − | </pre>
| |
When evaluating read mappers, we should always focus on well defined sets of reads:
SNPs and errors are different because SNPs can lead to mismatches in high-quality bases. In addition to integrating according to the metrics above, we could separate results by the number of errors in each read.
We should evaluate mapping qualities by counting how many reads are assigned each mapping quality (or greater) and among those how many map correctly or incorrectly. This gives a Heng Li graph, where one plots number of correctly mapped reads vs. number of mismapped reads.
