Evaluating a Read Mapper on Simulated Data

From Genome Analysis Wiki
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

Grouping

When evaluating read mappers, we should always focus on well defined sets of reads:

  • Reads with no polymorphisms.
  • Reads with 1, 2, 3 or more SNPs.
  • Reads with specific types of short indels (<10bp).
  • Reads with larger structural variants (>100bp).

SNPs and errors are different because SNPs can lead to mismatches in high-quality bases. In addition to integrating according to the metrics above, we could separate results by the number of errors in each read.

Should also be grouped according to whether reads are paired-end or single-end and according to read-length.

Bulk Statistics

  • Speed (millions of reads per hour)
  • Memory requirements
  • Size of output files
  • Raw count of mapped reads

Mapping Accuracy

The key quantities are:

  • How many reads were not mapped at all?
  • How many reads were mapped incorrectly? This is the least desirable outcome.
  • How many reads were mapped correctly?

Correct mapping should be defined as:

  • Most stringent: matches simulated location and CIGAR string.
  • Less stringent: overlaps simulated location at base-pair level, CIGAR string and end positions may differ.
  • Incorrect: Doesn't overlap simulated location.

Mapping Qualities

We should evaluate mapping qualities by counting how many reads are assigned each mapping quality (or greater) and among those how many map correctly or incorrectly. This gives a Heng Li graph, where one plots number of correctly mapped reads vs. number of mismapped reads.

Available Test Datasets

  • Location: wonderland:~zhanxw/BigSimulation
  • Scenarios:

no polymorphism ; 1, 2, 3 SNP ; Deletion 5, 30, 200; Insertion 5, 30

  • Quality String

Picked the 75 percentile of Sanger Iluumina 108 mer test data set

  • Format
Both base space and color space
Both single end and paired end, and paired end reads are given insert size 1500.
Forward strand and reverse strand are randomly assign with probability 1/2
  • Tag

@2:12345:F:SE:Exact @2:12345:F:SE:SNP:2,12345,A,G;2,12346,T,C @2:12345:F:PE+offset:SNP:2,12345,A,G (ref is A, read is G) @2:12345:F:PE+offset:Indel:25M30D5M

  • File Naming

BS_SE_EXACT_1M_50 BS_SE_SNP1_1M_50 CS_SE_INDEL1_1M CS_SE_INDEL30_1M CS_SE_INDEL200_1M CS_SE_DEL1_1M

For PE, appending "_1" and "_2", e.g.: PE_EXACT_1M_1 PE_EXACT_1M_2

  • Program (generator)

Usage:

        generator [bs|cs] [se|pe] [exact|snpXX|indelXX|delXX] -n numbers -l readLength -i insertSize
        exact: Accurate sample from reference genome
        snpXX: Bring total XXX SNP for a single read or a pair of reads
        indelXX: Insert a random XX-length piece for a single read, or at the same position for a paired reads
        delXX: Delete a random XX-length piece for a single read, or at the same position for a paired reads
        e.g. ./generator bs se exact -n 100 -l 35
  • Output

Simulation file are named like: BS_SE_EXACT_1000000_35, meaning base space, single end, exact (no polymorphism), 1M reads, 35 bp per read. For each read, the tag was named in a similar way to Sanger's.

  • Example

For illumina (from Sanger, 108mer hap1 test file): Example: _1 file: @20:14812275:F:217;None;None/1 AGTTGTTTACTTTCCTTTCCTACCTGGCTGCATCTGTCACATGCATATAGTGTCCCCTGACATGAAGCTCTGATATTGATCTGGAGCCCTATTGGTCTGCAAGTGACT + %27::2:::<70<<::95<<6/8<.)3;::9-,3:6/67731/.+)66;;53'31;9<815.%%%+%4-%%%90-)./26<831))(.%%%%%%%)%0%2%%%%%+%%

@15:59364621:R:-118;None;None/1 TGTTCAACCCACTATTAAGCCAGTATTAAATTGTTAATATCAGTTATTATACTTTTATTTCTAAAATTTCTATTTGATCCCTTTTTTTATAAACTCCAATGCATTCTC + %%2=;28>>>>=><>>>>>=>>=>>>;>=>9<1%+,//0+)<<91<4=;;<.%)2::8;;/9<;;;;8647<<;8;;066:<:4628;;;;5:9<<0/25752:3482

_2 file: @20:14812275:F:217;None;None/2 CACTGGAGGGAATCCAATCCCAAATTAATATAACAAAACCAGAAGCTTGCTTAAAAAATATTTTATCAGATTCCAAAGTTGAGCTTGTGTTAGGGTGTACTGGAACTC + %%0;+250::-863486::599<9679/2%%))%+80%--7<;9/1%33,-%%)28/),3,67-8;56<1%)0/%%8;<;59/%%,())%%1%%+%).%099'4;+%-

@15:59364621:R:-118;None;None/2 AGAAATAAGACCACATGACAATGTTAAAAATAAAACAGGCAATAGCAATAGTCCCAGAGGTGGTTACAATATGATTTCATGCTCCAGAAAGTATAGGAGAAGACAAAG + %3===;==;7<<;7<5;==<<4<;9=8==<====:<<<<<;<==:=<58;===;:8'8:<===:.9:38908:=;;7;57)%.+%)967%%-%%'6:-%)7);<;0+%

Conclusion: If the first read is forward, then itself is the same as reference sequence and the second read is reverse complement to the reference sequence. If the first read is backward, then itself is reverse complement to the reference genome and the second read is the same as the reference sequence. The first strand always position can always obtain from tag, first two fields (seperated by colon). The second strand position is first strand position plus the offset.

For SOLiD (from Sanger, 50 mer hap1 test file) e.g. _1 file: >2:67043752:F:1445;2,67043761,A,G;None T12221203021201200302123102221322000012301300211213

 22212031230012003021211022213220000123013022112123 (ref)

>4:125830377:R:-1541;None;None T30002222300330113020203010322111010300030003230320

_2 file: >2:67043752:F:1445;2,67043761,A,G;None G13031223023023012201210020003310110111111203310211

 30312230230230122012100200033121201111113033112112 (ref)

>4:125830377:R:-1541;None;None G13311131230200010201210032223330120312000301230032

Conclusion: The first strand and second strand have the same direction (both either same as the reference genome, or reverse complement to reference genome), where their positions are the same as Illumina reads.


Bulk statistics result

Running time (all submitted to the MOSIX client nodes)
Calculated by "./parseRunbatch.py batch2.log |cutrange 0,-1|charrange :-1".

Log file is from runbatch.pl and negative time means unfinished (at the moment of editing).

TODO: Add file size comparison; add link to memory page summarized by Dharknes.

BWA(second)	Karma(second)	Scenarios
2594	7182	BS_SE_DEL200_1000000_50.fastq
2641	-1	BS_SE_DEL30_1000000_50.fastq
2355	-1	BS_SE_DEL5_1000000_50.fastq
441	7941	BS_SE_EXACT_1000000_50.fastq
809	282	BS_SE_INDEL30_1000000_50.fastq
2217	-1	BS_SE_INDEL5_1000000_50.fastq
645	7206	BS_SE_SNP1_1000000_50.fastq
1102	-1	BS_SE_SNP2_1000000_50.fastq
1142	-1	BS_SE_SNP3_1000000_50.fastq
6536	8874	BS_PE_DEL200_1000000_50_?.fastq
6699	9017	BS_PE_DEL30_1000000_50_?.fastq
6468	9033	BS_PE_DEL5_1000000_50_?.fastq
1743	10112	BS_PE_EXACT_1000000_50_?.fastq
2305	231	BS_PE_INDEL30_1000000_50_?.fastq
5703	2989	BS_PE_INDEL5_1000000_50_?.fastq
1974	3718	BS_PE_SNP1_1000000_50_?.fastq
2396	3339	BS_PE_SNP2_1000000_50_?.fastq
2817	3131	BS_PE_SNP3_1000000_50_?.fastq
4362	16074	CS_PE_DEL200_1000000_50_?.fastq
4385	-1	CS_PE_DEL30_1000000_50_?.fastq
4373	9287	CS_PE_DEL5_1000000_50_?.fastq
773	-1	CS_PE_EXACT_1000000_50_?.fastq
1735	3142	CS_PE_INDEL30_1000000_50_?.fastq
4023	8591	CS_PE_INDEL5_1000000_50_?.fastq
1034	10528	CS_PE_SNP1_1000000_50_?.fastq
2236	-1	CS_PE_SNP2_1000000_50_?.fastq
3810	6617	CS_PE_SNP3_1000000_50_?.fastq
7129	1493	CS_SE_DEL200_1000000_50.fastq
7115	1513	CS_SE_DEL30_1000000_50.fastq
7065	1542	CS_SE_DEL5_1000000_50.fastq
1544	1666	CS_SE_EXACT_1000000_50.fastq
2954	289	CS_SE_INDEL30_1000000_50.fastq
6547	1390	CS_SE_INDEL5_1000000_50.fastq
1690	1661	CS_SE_SNP1_1000000_50.fastq
2853	1449	CS_SE_SNP2_1000000_50.fastq
4039	1237	CS_SE_SNP3_1000000_50.fastq