3,045
edits
Changes
From Genome Analysis Wiki
Jump to navigationJump to searchno edit summary
Each Alignment has:
Each Alignment has:
* query name, QNAME (SAM)/read_name (BAM). It is used to group/identify alignments that are together, like paired alignments or a read that appears in multiple alignments.
* query name, QNAME (SAM)/read_name (BAM). It is used to group/identify alignments that are together, like paired alignments or a read that appears in multiple alignments.
* FLAG
* a bitwise set of information describing the alignment, FLAG:
** are there multiple fragments
Not all alignments contain The rest of the alignment fields may be set to default values if the information is unknown.
Not all alignments contain The rest of the alignment fields may be set to default values if the information is unknown.
* leftmost position of where the next alignment in this group maps to the reference, MPOS or PNEXT. For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based. Beware to always use the correct base when referencing positions.
* leftmost position of where the next alignment in this group maps to the reference, MPOS or PNEXT. For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based. Beware to always use the correct base when referencing positions.
* length of this group from the leftmost position to the rightmost position, ISIZE or TLEN
* length of this group from the leftmost position to the rightmost position, ISIZE or TLEN
* the sequence for this alignment, SEQ
* the query sequence for this alignment, SEQ
* the quality for this alignment, QUAL
* the query quality for this alignment, QUAL, one for each base in the query sequence.
* Additional optional information is also contained within the alignment, TAGS. A bunch of different information can be stored here and they appear as key/value pairs. See the spec for a detailed list of commonly used tags and what they mean.
* Additional optional information is also contained within the alignment, TAGS. A bunch of different information can be stored here and they appear as key/value pairs. See the spec for a detailed list of commonly used tags and what they mean.
== Example SAM ==
== Example SAM ==
=== Example Alignments ===
This is what the alignment section of a SAM file looks like:
1:497:R:-272+13M17D24M 113 1 497 37 37M 15 100338662 0 CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG 0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>> XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
19:20389:F:275+18M2D19M 99 1 17644 0 37M = 17919 314 TATGACTGCTAATAATACCTACACATGTTAGAACCAT >>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
19:20389:F:275+18M2D19M 147 1 17919 0 18M2D19M = 17644 -314 GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT ;44999;499<8<8<<<8<<><<<<><7<;<<<>><< XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:18^CA19
9:21597+10M2I25M:R:-209 83 1 21678 0 8M2I27M = 21469 -244 CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT <;9<<5><<<<><<<>><<><>><9>><>>>9>>><> XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:35
In this example, the fields are:
{| style="margin: 1em 1em 1em 0; background-color: #f9f9f9; border: 1px #aaa solid; border-collapse: collapse;" border="1"
|-style="background: #f2f2f2; text-align: center;"
! '''Field''' !! '''Alignment 1''' !! '''Alignment 2''' !! '''Alignment 3''' !! '''Alignment 4'''
|-
|QNAME
|1:497:R:-272+13M17D24M
|19:20389:F:275+18M2D19M
|19:20389:F:275+18M2D19M
|9:21597+10M2I25M:R:-209
|-
|FLAG
|113
|99
|147
|83
|-
|RNAME
|1
|1
|1
|1
|-
|POS
|497
|17644
|17919
|21678
|-
|MAPQ
|37
|0
|0
|0
|-
|CIGAR
|37M
|37M
|18M2D19M
|8M2I27M
|-
|MRNM/RNEXT
|15
|=
|=
|=
|-
|MPOS/PNEXT
|100338662
|17919
|17644
|21469
|-
|ISIZE/TLEN
|0
|314
|-314
|-244
|-
|SEQ
|CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG
|TATGACTGCTAATAATACCTACACATGTTAGAACCAT
|GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT
|CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT
|-
|QUAL
|0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>>
|>>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9
|;44999;499<8<8<<<8<<><<<<><7<;<<<>><<
|<;9<<5><<<<><<<>><<><>><9>><>>>9>>><>
|-
|TAGs
|XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
|XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
|XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:18^CA19
|XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:35
|}
