Open main menu

Genome Analysis Wiki β

Changes

SAM

2,359 bytes added, 11:51, 29 July 2010
no edit summary
Each Alignment has:
* query name, QNAME (SAM)/read_name (BAM). It is used to group/identify alignments that are together, like paired alignments or a read that appears in multiple alignments.
* a bitwise set of information describing the alignment, FLAG:** are there multiple fragments
Not all alignments contain The rest of the alignment fields may be set to default values if the information is unknown.
* leftmost position of where the next alignment in this group maps to the reference, MPOS or PNEXT. For SAM, the reference starts at 1, so this value is 1-based, while for BAM the reference starts at 0,so this value is 0-based. Beware to always use the correct base when referencing positions.
* length of this group from the leftmost position to the rightmost position, ISIZE or TLEN
* the query sequence for this alignment, SEQ* the query quality for this alignment, QUAL, one for each base in the query sequence.
* Additional optional information is also contained within the alignment, TAGS. A bunch of different information can be stored here and they appear as key/value pairs. See the spec for a detailed list of commonly used tags and what they mean.
== Example SAM ==
=== Example Alignments ===
This is what the alignment section of a SAM file looks like:
 
1:497:R:-272+13M17D24M 113 1 497 37 37M 15 100338662 0 CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG 0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>> XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
19:20389:F:275+18M2D19M 99 1 17644 0 37M = 17919 314 TATGACTGCTAATAATACCTACACATGTTAGAACCAT >>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
19:20389:F:275+18M2D19M 147 1 17919 0 18M2D19M = 17644 -314 GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT ;44999;499<8<8<<<8<<><<<<><7<;<<<>><< XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:18^CA19
9:21597+10M2I25M:R:-209 83 1 21678 0 8M2I27M = 21469 -244 CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT <;9<<5><<<<><<<>><<><>><9>><>>>9>>><> XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:35
 
In this example, the fields are:
{| style="margin: 1em 1em 1em 0; background-color: #f9f9f9; border: 1px #aaa solid; border-collapse: collapse;" border="1"
|-style="background: #f2f2f2; text-align: center;"
! '''Field''' !! '''Alignment 1''' !! '''Alignment 2''' !! '''Alignment 3''' !! '''Alignment 4'''
|-
|QNAME
|1:497:R:-272+13M17D24M
|19:20389:F:275+18M2D19M
|19:20389:F:275+18M2D19M
|9:21597+10M2I25M:R:-209
|-
|FLAG
|113
|99
|147
|83
|-
|RNAME
|1
|1
|1
|1
|-
|POS
|497
|17644
|17919
|21678
|-
|MAPQ
|37
|0
|0
|0
|-
|CIGAR
|37M
|37M
|18M2D19M
|8M2I27M
|-
|MRNM/RNEXT
|15
|=
|=
|=
|-
|MPOS/PNEXT
|100338662
|17919
|17644
|21469
|-
|ISIZE/TLEN
|0
|314
|-314
|-244
|-
|SEQ
|CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG
|TATGACTGCTAATAATACCTACACATGTTAGAACCAT
|GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT
|CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT
|-
|QUAL
|0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>>
|>>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9
|;44999;499<8<8<<<8<<><<<<><7<;<<<>><<
|<;9<<5><<<<><<<>><<><>><9>><>>>9>>><>
|-
|TAGs
|XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
|XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37
|XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:18^CA19
|XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:35
|}