Changes

From Genome Analysis Wiki
Jump to navigationJump to search

BamUtil (view source)

Revision as of 13:00, 13 October 2010

643 bytes removed ,  13:00, 13 October 2010
no edit summary
Line 116: Line 116:  
=== Example Output ===
 
=== Example Output ===
 
<pre>
 
<pre>
−
The following parameters are available.  Ones with "[]" are in effect:
  −
  −
Input Parameters
  −
--in [test/testFiles/sortedBam.bam], --out [chromosome], --bamIndex [],
  −
                --noeof
  −
  Output Type : --bamout [ON], --samout
  −
   
Reference ID -1 has 2 records
 
Reference ID -1 has 2 records
 
Reference ID 0 has 5 records
 
Reference ID 0 has 5 records
Line 182: Line 175:  
=== Example Output ===
 
=== Example Output ===
 
<pre>
 
<pre>
−
The following parameters are available.  Ones with "[]" are in effect:
  −
  −
Input Parameters
  −
--in [test/testFiles/sortedBam.bam], --out [t.sam], --bamIndex [],
  −
--refName [], --refID, --start [1], --end [100], --noeof
      
Wrote t.sam with 2 records.
 
Wrote t.sam with 2 records.
Line 279: Line 267:  
=== Example Output ===
 
=== Example Output ===
 
<pre>
 
<pre>
−
The following parameters are available.  Ones with "[]" are in effect:
  −
Input Parameters
  −
--refFile [/home/mktrost/data/human.g1k.v37.fa], --refName [1],
  −
--start [43000], --end [-1], --numBases [71]
      
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.
 
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.
 
GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA
 
GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA
 
</pre>
 
</pre>
Retrieved from "http://genome.sph.umich.edu/wiki/Special:MobileDiff/2237"

Navigation menu