Difference between revisions of "Tandem Repeat Concepts"
(10 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
= Introduction = | = Introduction = | ||
− | This | + | Tandem repeats are a common polymorphism in the genome. |
+ | |||
+ | This wiki is an attempt at consolidation on past work by many people | ||
+ | |||
+ | We talk about its representation, major characteristics, and a set of useful definitions and algorithms for working with them | ||
+ | |||
+ | * Gary Benson's tandem repeat finder's | ||
+ | * Gymrek et al. | ||
+ | * Highnam et al. | ||
= Definition = | = Definition = | ||
Line 11: | Line 19: | ||
== Motif Canonical Class == | == Motif Canonical Class == | ||
+ | |||
+ | Using the concepts of shifting, the canonical class of a set of motifs can be defined as | ||
+ | a equivalence relationship. | ||
+ | |||
+ | ACG ~ CGA if there exists a shift that allows s(ACG, i) = CGA | ||
+ | |||
+ | This relationship can be show to be reflexive, symmetric and transitive. And a equivalence | ||
+ | class can be defined on this. | ||
+ | |||
+ | Example: | ||
+ | |||
+ | This is a distribution of motifs without collapsing | ||
+ | |||
+ | A | ||
+ | C | ||
+ | G | ||
+ | T | ||
+ | AA | ||
+ | CC | ||
+ | GG | ||
+ | TT | ||
+ | AC | ||
+ | AG | ||
+ | AT | ||
+ | CG | ||
+ | CT | ||
+ | GT | ||
+ | CA | ||
+ | GA | ||
+ | |||
+ | show all permutations | ||
+ | show acyclic | ||
+ | show shift | ||
+ | show reverse complement | ||
+ | |||
+ | |||
+ | |||
+ | |||
=== Shifting === | === Shifting === | ||
Line 57: | Line 103: | ||
== Fractional counts == | == Fractional counts == | ||
+ | |||
+ | While it is natural to think of a stretch of repeat as a integer, it is useful to consider fractional counts of a repeat especially in large repeat tracts. | ||
+ | This is done in Tandem Repeat Finder. | ||
+ | |||
+ | GGGTTAAGGGTTAAGGGTTAAGGGTTAAGGGTTAAGGG | ||
+ | |||
+ | This is 5.5 copies of the repeat GGGTTAA | ||
== Scoring == | == Scoring == | ||
+ | |||
+ | You can use a score bounded by one. | ||
+ | |||
+ | By random matching - | ||
== TRF Scoring == | == TRF Scoring == | ||
− | + | A nice useful scheme is +2 for matches and -7 for indels and mismatches, and it provides a convenient way of scoring for purity. | |
+ | == Inexact Tandem Repeats == | ||
+ | We see alot of this | ||
− | + | AAAAAAAAAAAGAAAAAAAAAAAAAA | |
+ | or | ||
+ | |||
+ | ACACACACACACGACACACAACACACACACAC | ||
+ | |||
+ | or | ||
+ | |||
+ | GAAAGAAGGAAAAGAGAGAAAAGAAGAAGAA | ||
+ | |||
+ | = Characteristics = | ||
+ | |||
* motif length | * motif length | ||
* motif basis | * motif basis | ||
− | * repeat tract | + | * repeat tract length |
* purity | * purity | ||
+ | |||
+ | questions. | ||
+ | |||
+ | Is AAAAC really different from AAAAAC? | ||
+ | |||
+ | |||
== Algorithm for Detection == | == Algorithm for Detection == | ||
+ | Exact alignment algorithm | ||
+ | Fuzzy alignment algorithm | ||
== Detection of a motif in a sequence == | == Detection of a motif in a sequence == | ||
+ | The following shows the trace of how the algorithm works | ||
+ | ============================================ | ||
+ | ANNOTATING INDEL FUZZILY | ||
+ | ******************************************** | ||
+ | EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT | ||
+ | |||
+ | 20:131948:C/CCA | ||
+ | EXACT REGION 131948-131965 (18) | ||
+ | CCACACACACACACACAA | ||
+ | FINAL EXACT REGION 131948-131965 (18) | ||
+ | CCACACACACACACACAA | ||
+ | ******************************************** | ||
+ | PICK CANDIDATE MOTIFS | ||
+ | |||
+ | Longest Allele : C[CA]CACACACACACACACAA | ||
+ | detecting motifs for an str | ||
+ | seq: CCACACACACACACACACAA | ||
+ | len : 20 | ||
+ | cmax_len : 10 | ||
+ | candidate motifs: 25 | ||
+ | AC : 0.894737 2 0 | ||
+ | AAC : 0.5 3 0.0555556 | ||
+ | ACC : 0.5 3 0.0555556 | ||
+ | AAAC : 0.0588235 4 0.125 (< 2 copies) | ||
+ | ACCC : 0.0588235 4 0.125 (< 2 copies) | ||
+ | AACAC : 0.5 5 0.02 | ||
+ | ACACC : 0.5 5 0.02 | ||
+ | AAACAC : 0.0666667 6 0.0555556 (< 2 copies) | ||
+ | ACACCC : 0.0666667 6 0.0555556 (< 2 copies) | ||
+ | AACACAC : 0.5 7 0.0102041 | ||
+ | ACACACC : 0.5 7 0.0102041 | ||
+ | AAACACAC : 0.0769231 8 0.03125 (< 2 copies) | ||
+ | ACACACCC : 0.0769231 8 0.03125 (< 2 copies) | ||
+ | AACACACAC : 0.5 9 0.00617284 (< 2 copies) | ||
+ | ACACACACC : 0.5 9 0.00617284 (< 2 copies) | ||
+ | AAACACACAC : 0.0909091 10 0.02 (< 2 copies) | ||
+ | ACACACACCC : 0.0909091 10 0.02 (< 2 copies) | ||
+ | ******************************************** | ||
+ | PICKING NEXT BEST MOTIF | ||
+ | |||
+ | selected: AC 0.89 0.00 | ||
+ | ******************************************** | ||
+ | DETECTING REPEAT TRACT FUZZILY | ||
+ | ++++++++++++++++++++++++++++++++++++++++++++ | ||
+ | Exact left/right alignment | ||
+ | |||
+ | repeat_tract : CACACACACACACACA | ||
+ | position : [131949,131964] | ||
+ | motif_concordance : 1 | ||
+ | repeat units : 8 | ||
+ | exact repeat units : 8 | ||
+ | total no. of repeat units : 8 | ||
+ | |||
+ | ++++++++++++++++++++++++++++++++++++++++++++ | ||
+ | Fuzzy right alignment | ||
+ | |||
+ | repeat motif : CA | ||
+ | rflank : AACTC | ||
+ | mlen : 2 | ||
+ | rflen : 5 | ||
+ | plen : 111 | ||
+ | |||
+ | read : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC | ||
+ | rlen : 106 | ||
+ | |||
+ | optimal score: 50.5073 | ||
+ | optimal state: MR | ||
+ | optimal track: MR|r|0|5 | ||
+ | optimal probe len: 25 | ||
+ | optimal path length : 107 | ||
+ | max j: 106 | ||
+ | probe: (1~82) [1~10] (1~5) | ||
+ | read : (1~82) [83~101] (102~106) | ||
+ | |||
+ | motif # : 10 [83,101] | ||
+ | motif concordance : 95% (9/10) | ||
+ | motif discordance : 0|1|0|0|0|0|0|0|0|0 | ||
+ | |||
+ | Model: ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC | ||
+ | SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME | ||
+ | oo++oo++oo++oo++oo++RRRRR | ||
+ | Read: AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC | ||
+ | |||
+ | ++++++++++++++++++++++++++++++++++++++++++++ | ||
+ | Fuzzy left alignment | ||
+ | |||
+ | lflank : ATCTTA | ||
+ | repeat motif : CA | ||
+ | lflen : 6 | ||
+ | mlen : 2 | ||
+ | plen : 111 | ||
+ | |||
+ | read : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT | ||
+ | rlen : 105 | ||
+ | |||
+ | optimal score: 50.5858 | ||
+ | optimal state: Z | ||
+ | optimal track: Z|m|10|2 | ||
+ | optimal probe len: 26 | ||
+ | optimal path length : 106 | ||
+ | max j: 105 | ||
+ | mismatch penalty: 3 | ||
+ | |||
+ | model: (1~6) [1~10] | ||
+ | read : (1~6) [7~25][26~106] | ||
+ | |||
+ | motif # : 10 [7,25] | ||
+ | motif concordance : 95% (9/10) | ||
+ | motif discordance : 0|1|0|0|0|0|0|0|0|0 | ||
+ | |||
+ | Model: ATCTTACACACACACACACACACACA-------------------------------------------------------------------------------- | ||
+ | SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE | ||
+ | LLLLLLoo++oo++oo++oo++oo++ | ||
+ | Read: ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT | ||
+ | |||
+ | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
+ | VNTR Summary | ||
+ | rid : 19 | ||
+ | motif : AC | ||
+ | ru : CA | ||
+ | |||
+ | Exact | ||
+ | repeat_tract : CACACACACACACACA | ||
+ | position : [131949,131964] | ||
+ | reference repeat unit length : 8 | ||
+ | motif_concordance : 1 | ||
+ | repeat units : 8 | ||
+ | exact repeat units : 8 | ||
+ | total no. of repeat units : 8 | ||
+ | |||
+ | Fuzzy | ||
+ | repeat_tract : CACCACACACACACACACA | ||
+ | position : [131946,131964] | ||
+ | reference repeat unit length : 19 | ||
+ | motif_concordance : 0.95 | ||
+ | repeat units : 19 | ||
+ | exact repeat units : 9 | ||
+ | total no. of repeat units : 10 | ||
+ | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
== Model free left alignment and right alignment == | == Model free left alignment and right alignment == |
Latest revision as of 19:17, 25 February 2016
Introduction
Tandem repeats are a common polymorphism in the genome.
This wiki is an attempt at consolidation on past work by many people
We talk about its representation, major characteristics, and a set of useful definitions and algorithms for working with them
- Gary Benson's tandem repeat finder's
- Gymrek et al.
- Highnam et al.
Definition
A series of repeats that are contiguous
Concepts
Motif Canonical Class
Using the concepts of shifting, the canonical class of a set of motifs can be defined as a equivalence relationship.
ACG ~ CGA if there exists a shift that allows s(ACG, i) = CGA
This relationship can be show to be reflexive, symmetric and transitive. And a equivalence class can be defined on this.
Example:
This is a distribution of motifs without collapsing
A C G T AA CC GG TT AC AG AT CG CT GT CA GA
show all permutations show acyclic show shift show reverse complement
Shifting
Consider the motifs ACTT, TACT and TTAC, the following stretches can be observed in the genome
GGGGGGACTTACTTACTTACTTACTTAGGGGG GGGGGGTACTTACTTACTTACTTACTTGGGGG GGGGGGTTACTTACTTACTTACTTACTGGGGG
but looking from the right flank, they can easily be CTTA, ACTT and TACT respectively.
The concept of shifting the sequence is useful for grouping such like motifs together.
We define shift as follow
A shift of a sequence is the sliding of the sequence with the alleles wrapped to the front?
Reverse Complement
Reverse complement is is a common concept in sequence analysis.
ACCCTCCCCTCT AGAGGGGAGGGT
Acyclicity
Motifs are required to be acyclic. For example, a motif ACACAC should just be represented by AC as it is 3 copies of AC.
A sequence is cyclic if and only if there exists a sub sequence in which it is a multiple copy of.
The definition can be more explicit as follows:
A sequence is cyclic if and only if there exists a non trivial shift of the sequence that is equivalent to the sequence.
Take for example, the sequence ACACA, is this a bona fide motif? After it seems like it is 2.5 copies of AC and AC might be more appropriate.
shift 0: ACACA shift 1: CACAA shift 2: ACAAC shift 3: CAACA shift 4: AACAC
So ACACA is a bona fide motif.
Fractional counts
While it is natural to think of a stretch of repeat as a integer, it is useful to consider fractional counts of a repeat especially in large repeat tracts. This is done in Tandem Repeat Finder.
GGGTTAAGGGTTAAGGGTTAAGGGTTAAGGGTTAAGGG
This is 5.5 copies of the repeat GGGTTAA
Scoring
You can use a score bounded by one.
By random matching -
TRF Scoring
A nice useful scheme is +2 for matches and -7 for indels and mismatches, and it provides a convenient way of scoring for purity.
Inexact Tandem Repeats
We see alot of this
AAAAAAAAAAAGAAAAAAAAAAAAAA
or
ACACACACACACGACACACAACACACACACAC
or
GAAAGAAGGAAAAGAGAGAAAAGAAGAAGAA
Characteristics
- motif length
- motif basis
- repeat tract length
- purity
questions.
Is AAAAC really different from AAAAAC?
Algorithm for Detection
Exact alignment algorithm
Fuzzy alignment algorithm
Detection of a motif in a sequence
The following shows the trace of how the algorithm works
============================================ ANNOTATING INDEL FUZZILY ******************************************** EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT 20:131948:C/CCA EXACT REGION 131948-131965 (18) CCACACACACACACACAA FINAL EXACT REGION 131948-131965 (18) CCACACACACACACACAA ******************************************** PICK CANDIDATE MOTIFS Longest Allele : C[CA]CACACACACACACACAA detecting motifs for an str seq: CCACACACACACACACACAA len : 20 cmax_len : 10 candidate motifs: 25 AC : 0.894737 2 0 AAC : 0.5 3 0.0555556 ACC : 0.5 3 0.0555556 AAAC : 0.0588235 4 0.125 (< 2 copies) ACCC : 0.0588235 4 0.125 (< 2 copies) AACAC : 0.5 5 0.02 ACACC : 0.5 5 0.02 AAACAC : 0.0666667 6 0.0555556 (< 2 copies) ACACCC : 0.0666667 6 0.0555556 (< 2 copies) AACACAC : 0.5 7 0.0102041 ACACACC : 0.5 7 0.0102041 AAACACAC : 0.0769231 8 0.03125 (< 2 copies) ACACACCC : 0.0769231 8 0.03125 (< 2 copies) AACACACAC : 0.5 9 0.00617284 (< 2 copies) ACACACACC : 0.5 9 0.00617284 (< 2 copies) AAACACACAC : 0.0909091 10 0.02 (< 2 copies) ACACACACCC : 0.0909091 10 0.02 (< 2 copies) ******************************************** PICKING NEXT BEST MOTIF selected: AC 0.89 0.00 ******************************************** DETECTING REPEAT TRACT FUZZILY ++++++++++++++++++++++++++++++++++++++++++++ Exact left/right alignment repeat_tract : CACACACACACACACA position : [131949,131964] motif_concordance : 1 repeat units : 8 exact repeat units : 8 total no. of repeat units : 8 ++++++++++++++++++++++++++++++++++++++++++++ Fuzzy right alignment repeat motif : CA rflank : AACTC mlen : 2 rflen : 5 plen : 111 read : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC rlen : 106 optimal score: 50.5073 optimal state: MR optimal track: MR|r|0|5 optimal probe len: 25 optimal path length : 107 max j: 106 probe: (1~82) [1~10] (1~5) read : (1~82) [83~101] (102~106) motif # : 10 [83,101] motif concordance : 95% (9/10) motif discordance : 0|1|0|0|0|0|0|0|0|0 Model: ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME oo++oo++oo++oo++oo++RRRRR Read: AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC ++++++++++++++++++++++++++++++++++++++++++++ Fuzzy left alignment lflank : ATCTTA repeat motif : CA lflen : 6 mlen : 2 plen : 111 read : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT rlen : 105 optimal score: 50.5858 optimal state: Z optimal track: Z|m|10|2 optimal probe len: 26 optimal path length : 106 max j: 105 mismatch penalty: 3 model: (1~6) [1~10] read : (1~6) [7~25][26~106] motif # : 10 [7,25] motif concordance : 95% (9/10) motif discordance : 0|1|0|0|0|0|0|0|0|0 Model: ATCTTACACACACACACACACACACA-------------------------------------------------------------------------------- SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE LLLLLLoo++oo++oo++oo++oo++ Read: ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx VNTR Summary rid : 19 motif : AC ru : CA Exact repeat_tract : CACACACACACACACA position : [131949,131964] reference repeat unit length : 8 motif_concordance : 1 repeat units : 8 exact repeat units : 8 total no. of repeat units : 8 Fuzzy repeat_tract : CACCACACACACACACACA position : [131946,131964] reference repeat unit length : 19 motif_concordance : 0.95 repeat units : 19 exact repeat units : 9 total no. of repeat units : 10 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
Model free left alignment and right alignment
Model based fuzzy left alignment and right alignment
Model free fuzzy left alignment and right alignment
Implementation
This is implemented in vt.
Citation
Maintained by
This page is maintained by Adrian.