Tandem Repeat Concepts
Contents
Introduction
This page is about Tandem Repeats.
Definition
A series of repeats that are contiguous
Concepts
Motif Canonical Class
Shifting
Consider the motifs ACTT, TACT and TTAC, the following stretches can be observed in the genome
GGGGGGACTTACTTACTTACTTACTTAGGGGG GGGGGGTACTTACTTACTTACTTACTTGGGGG GGGGGGTTACTTACTTACTTACTTACTGGGGG
but looking from the right flank, they can easily be CTTA, ACTT and TACT respectively.
The concept of shifting the sequence is useful for grouping such like motifs together.
We define shift as follow
A shift of a sequence is the sliding of the sequence with the alleles wrapped to the front?
Reverse Complement
Reverse complement is is a common concept in sequence analysis.
ACCCTCCCCTCT AGAGGGGAGGGT
Acyclicity
Motifs are required to be acyclic. For example, a motif ACACAC should just be represented by AC as it is 3 copies of AC.
A sequence is cyclic if and only if there exists a sub sequence in which it is a multiple copy of.
The definition can be more explicit as follows:
A sequence is cyclic if and only if there exists a non trivial shift of the sequence that is equivalent to the sequence.
Take for example, the sequence ACACA, is this a bona fide motif? After it seems like it is 2.5 copies of AC and AC might be more appropriate.
shift 0: ACACA shift 1: CACAA shift 2: ACAAC shift 3: CAACA shift 4: AACAC
So ACACA is a bona fide motif.
Fractional counts
While it is natural to think of a stretch of repeat as a integer, it is useful to consider fractional counts of a repeat especially in large repeat tracts. This is done in Tandem Repeat Finder.
GGGTTAAGGGTTAAGGGTTAAGGGTTAAGGGTTAAGGG
This is 5.5 copies of the repeat GGGTTAA
Scoring
TRF Scoring
Normalized scoring
Classification
- motif length
- motif basis
- repeat tract lengfth
- purity
Algorithm for Detection
Detection of a motif in a sequence
Model free left alignment and right alignment
Model based fuzzy left alignment and right alignment
Model free fuzzy left alignment and right alignment
Implementation
This is implemented in vt.
Citation
Maintained by
This page is maintained by Adrian.