Difference between revisions of "Variant classification"

From Genome Analysis Wiki
Jump to: navigation, search
(Complex Biallelic Examples)
(Representation of close by variants)
(54 intermediate revisions by the same user not shown)
Line 3: Line 3:
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations.  However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.  
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations.  However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.  
On this wiki page, we describe a a variant classification system for VCF variants.
On this wiki page, we describe a a variant classification system for VCF entries that is invariant to [http://genome.sph.umich.edu/wiki/Variant_Normalization normalization] except for the case of MNPs.
= Definitions =
= Definitions =
The definition of a variant is based on the definition of each allele with respect to the reference sequence.  We consider 5 major types loosely defined as follows.
The definition of a variant is based on the definition of each allele with respect to the reference sequence.  We consider 5 major types loosely decribed as follows.
;1. SNP
;1. SNP
: The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
: The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
;2. MNP
;2. MNP
: a.The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
: The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
: OR
: OR
: b. all reference and alternate sequences have the same length.
: All reference and alternate sequences have the same length (this is applicable to all alleles).
: a. The reference and alternate sequence are not the same length.
: The reference and alternate sequences are not of the same length.
: b. The removal of a subsequence of the longer sequence would reduce the longer sequence to the smaller sequence.
a. A clumping of nearby SNPs, MNPs or Indels.
:  A clumping of nearby SNPs, MNPs or Indels.
;5. SV
;5. SV
: The alternate sequence is represented by a angled bracket tag.
: The alternate sequence is represented by an angled bracket tag.
= Classification Procedure =
#Trim each allele with respect to the reference sequence individually
#Inspect length, defined as length of alternate allele minus length of reference allele.
##if length = 0
###if length(ref) = 1 and nucleotides differ, classify as SNP  (count ts and tv too)
###if length(ref) > 1
####if all nucleotides differ, classify as MNP  (count ts and tv too)
####if not all nucleotides differ, classify as CLUMPED  (count ts and tv too)
##if length <math>\ne</math> 0, classify as INDEL
###if shorter allele is of length 1
####if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification
###if shorter allele length > 1
####compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)
#####if all nucleotides differ, add MNP classification
#####if not all nucleotides differ, add CLUMPED classification
#Variant classification is the union of the classifications of each allele present in the variant.
#If all alleles are the same length, add MNP classification.
= Examples =
= Examples =
We present the following examples to explain the concepts explained earlier.
We present the following examples to explain the classification described.
== Legend for examples ==
== Legend for examples ==
Line 32: Line 49:
     &lt;variant classification&gt;<br>
     &lt;variant classification&gt;<br>
     REF &lt;reference sequence&gt;       
     REF &lt;reference sequence&gt;       
     ALT &lt;alternative sequence&gt;      #&lt;allele classification&gt; , &lt;contribution to transition, transversion, insertion or deletion count&gt;   
     ALT &lt;alternative sequence 1&gt;      #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt;   
     ALT &lt;alternative sequence&gt;      #&lt;another allele classification&gt;
     ALT &lt;alternative sequence 2&gt;      #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt;
== Simple Biallelic Examples ==
== Simple Biallelic Examples ==
Line 39: Line 56:
     REF  A       
     REF  A       
     ALT  G   #SNP, 1 ts   
     ALT  G     #SNP, 1 ts   
     REF  AT     
     REF  AT     
     ALT  GC    #MPN, 2 ts
     ALT  GC    #MNP, 2 ts
Line 52: Line 69:
     REF  AT       
     REF  AT       
     ALT  T    #INDEL, 1 del
     ALT  T    #INDEL, 1 del
              #Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base. 
              #If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles.
              #Simple Indel classification should be invariant whether it is left or right aligned.
Line 61: Line 81:
     REF  AT           
     REF  AT           
     ALT  G          #SNP,INDEL, 1 ts
     ALT  G          #SNP, INDEL, 1 ts
                    #Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually
                    #not defined.  In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which
                    #is a transversion.  In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition
                    #and transversion contribution.  But please be very clear that this is an ambiguous case.  It is better to consider this simply
                    #as a complex variant.
     REF  ATT           
     REF  ATT           
     ALT  GG          #MNP,INDEL, ts, 1 tv, 1 del
     ALT  GG          #MNP, INDEL, 1 ts, 1 tv, 1 del
     REF  ATTTT         
     REF  ATTTT         
     ALT  GTTTC      #MNP,CLUMEPD, 2 ts
     ALT  GTTTC      #MNP, CLUMPED, 2 ts
    #since all the alleles are of the sample length, classified as MNP too.
                    #since all the alleles are of the same length, classified as MNP too.
Line 80: Line 105:
     REF  A       
     REF  A       
     ALT  G       #1 ts
     ALT  G           #SNP, 1 ts
     ALT  C       #1 tv
     ALT  C           #SNP, 1 tv
     REF  AG       
     REF  AG       
     ALT  GC     #1 ts, 1 tv
     ALT  GC         #MNP, 1 ts, 1 tv
     ALT  CT     #2 tv  
     ALT  CT         #MNP, 2 tv  
     REF  ATTT     
     REF  ATTT     
     ALT  ATT     #1 del
     ALT  ATT         #INDEL, 1 del
     ALT  ATTTT   #1 ins
     ALT  ATTTT       #INDEL, 1 ins
== Complex Multiallelic Examples ==
== Complex Multiallelic Examples ==
Line 97: Line 122:
     REF  AT     
     REF  AT     
     ALT  GT     #SNP, 1 ts
     ALT  GT         #SNP, 1 ts
     ALT  AC     #SNP, 1 ts
     ALT  AC         #SNP, 1 ts
    #since all the alleles are of the sample length, classified as MNP too.
                    #since all the alleles are of the sample length, classified as MNP too.
     REF  ATTTG     
     REF  ATTTG     
     ALT  GTTTC     #CLUMPED, 1 ts, 1 tv
     ALT  GTTTC       #CLUMPED, 1 ts, 1 tv
     ALT  ATTTC     #SNP, 1 tv
     ALT  ATTTC       #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP
    #since all the alleles are of the sample length, classified as MNP too.
                    #since all the alleles are of the sample length, classified as MNP too.
     REF  GT     
     REF  GT     
     ALT  CT   #SNP, 1 tv
     ALT  CT         #SNP, 1 tv
     ALT  AG   #MNP, 2 tv
     ALT  AG         #MNP, 2 tv
     ALT  GTT   #INDEL, 1 ins
     ALT  GTT         #INDEL, 1 ins
     REF  GTTT     
     REF  GTTT     
     ALT  CG   #MNP|INDEL, 2 tv, 1 del
     ALT  CG         #MNP, INDEL, 2 tv, 1 del
     ALT  AG   #MNP|INDEL, 1 ts, 1 tv
     ALT  AG         #MNP, INDEL, 1 ts, 1 tv
     ALT  GTGTG       #SNP, INDEL, CLUMPED, 1 tv, 1 ins
== Structured Variants Examples ==
    REF  G   
    ALT &lt;INS:ME:LINE1&gt;    #SV
    REF  G   
    ALT &lt;CN4&gt;            #SV
    ALT &lt;CN12&gt;            #SV
=Interesting Variant Types =
    Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. <br>
    20 9538655 <span style="color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> <STR>
    This can be induced as
    one record considering only the ATTT repeats
    20 9538655 <span style="color:#FF0000">ATTTATTTATTT </span> <span style="color:#FF0000">ATTT </span>
    one record with CATT repeats
    20 9538695 <span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>
    one record with a mix of both repeat types
    20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>
= Representation of close by variants =
== Weird Examples ==
    a single complex variant
    CHROM POS        REF  ALT
    1    124001690  C    AAA
== Structured Variants Examples ==
    an Indel and SNP adjacent to one another
    CHROM POS        REF  ALT
    1    124001689  T    TAA
    1    124001690  C    A
          no. of structural variants        :      41217       
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together.
              2 alleles                     :          38079
Representing it as 2 separate variants allows both alleles to segregate independently.
                  deletion                  :                13135          &lt;DEL&gt;
                  insertion                  :                16451          &lt;INS&gt;
                      mobile element          :                    16253      &lt;INS:ME&gt;
                        ALU                  :                        12513  &lt;INS:ME:ALU&gt;
                        LINE1                :                        2911  &lt;INS:ME:LINE1&gt;
                        SVA                  :                          829  &lt;INS:ME:SVA&gt;
                      numt                    :                      198      &lt;INS:MT&gt;
                  duplication                :                  664          &lt;DUP&gt;
                  inversion                  :                  100          &lt;INV&gt;
                  copy number variation      :                7729          &lt;CN4&gt;
              >=3 alleles                    :            3138
                  copy number variation      :                3138          &lt;CN4&gt;,&lt;CN8&gt;
= Output  =
= Output  =
Line 154: Line 207:
           3 alleles                      :            273 (0.89) [537/601]
           3 alleles                      :            273 (0.89) [537/601]
           4 alleles                      :              3 (1.00) [9/9] <br>
           4 alleles                      :              3 (1.00) [9/9] <br>
       no. of Indel                      :    6600770
       no. of Indel                      :    6600770   #also referred to as simple Indels
           2 alleles                      :        6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts
           2 alleles                      :        6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts
           3 alleles                      :          280892 (8.72) [503977/57807]
           3 alleles                      :          280892 (8.72) [503977/57807]
Line 208: Line 261:
           4 alleles                      :              34 (1.16) [109/94]  
           4 alleles                      :              34 (1.16) [109/94]  
           >=5 alleles                    :              4 (0.76) [13/17]  <br>
           >=5 alleles                    :              4 (0.76) [13/17]  <br>
       no. of Complex Substitutions      :    159298 #equivalent to categories not including simple SNPs, Block Substitutions and Simple Indels
       no. of Complex Substitutions      :    159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels
           2 alleles                      :          81508 (0.61) [60312/98113] (0.66) [32479/49029]
           2 alleles                      :          81508 (0.61) [60312/98113] (0.66) [32479/49029]
           3 alleles                      :          71003 (0.69) [35811/51840] (0.34) [34268/100942]
           3 alleles                      :          71003 (0.69) [35811/51840] (0.34) [34268/100942]

Latest revision as of 21:44, 25 February 2016


The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.

On this wiki page, we describe a a variant classification system for VCF entries that is invariant to normalization except for the case of MNPs.


The definition of a variant is based on the definition of each allele with respect to the reference sequence. We consider 5 major types loosely decribed as follows.

1. SNP
The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
2. MNP
The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
All reference and alternate sequences have the same length (this is applicable to all alleles).
The reference and alternate sequences are not of the same length.
A clumping of nearby SNPs, MNPs or Indels.
5. SV
The alternate sequence is represented by an angled bracket tag.

Classification Procedure

  1. Trim each allele with respect to the reference sequence individually
  2. Inspect length, defined as length of alternate allele minus length of reference allele.
    1. if length = 0
      1. if length(ref) = 1 and nucleotides differ, classify as SNP (count ts and tv too)
      2. if length(ref) > 1
        1. if all nucleotides differ, classify as MNP (count ts and tv too)
        2. if not all nucleotides differ, classify as CLUMPED (count ts and tv too)
    2. if length \ne 0, classify as INDEL
      1. if shorter allele is of length 1
        1. if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification
      2. if shorter allele length > 1
        1. compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)
          1. if all nucleotides differ, add MNP classification
          2. if not all nucleotides differ, add CLUMPED classification
  3. Variant classification is the union of the classifications of each allele present in the variant.
  4. If all alleles are the same length, add MNP classification.


We present the following examples to explain the classification described.

Legend for examples

   <variant classification>
REF <reference sequence> ALT <alternative sequence 1> #<allele classification>, <contribution to transition, transversion, insertion or deletion count> ALT <alternative sequence 2> #<allele classification>, <contribution to transition, transversion, insertion or deletion count>

Simple Biallelic Examples

REF A ALT G #SNP, 1 ts
REF AT ALT T #INDEL, 1 del #Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base. #If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles. #Simple Indel classification should be invariant whether it is left or right aligned.

Complex Biallelic Examples

REF AT ALT G #SNP, INDEL, 1 ts #Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually #not defined. In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which #is a transversion. In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition #and transversion contribution. But please be very clear that this is an ambiguous case. It is better to consider this simply #as a complex variant.
REF ATT ALT GG #MNP, INDEL, 1 ts, 1 tv, 1 del
REF ATTTT ALT GTTTC #MNP, CLUMPED, 2 ts #since all the alleles are of the same length, classified as MNP too.

Simple Multiallelic Examples

REF A ALT G #SNP, 1 ts ALT C #SNP, 1 tv
REF AG ALT GC #MNP, 1 ts, 1 tv ALT CT #MNP, 2 tv

Complex Multiallelic Examples

REF AT ALT GT #SNP, 1 ts ALT AC #SNP, 1 ts #since all the alleles are of the sample length, classified as MNP too.
REF ATTTG ALT GTTTC #CLUMPED, 1 ts, 1 tv ALT ATTTC #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP #since all the alleles are of the sample length, classified as MNP too.
REF GT ALT CT #SNP, 1 tv ALT AG #MNP, 2 tv ALT GTT #INDEL, 1 ins
REF GTTT ALT CG #MNP, INDEL, 2 tv, 1 del ALT AG #MNP, INDEL, 1 ts, 1 tv ALT GTGTG #SNP, INDEL, CLUMPED, 1 tv, 1 ins

Structured Variants Examples


Interesting Variant Types

   Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. 
   This can be induced as
   one record considering only the ATTT repeats
   20	9538655	ATTTATTTATTT  ATTT 
   one record with CATT repeats
   20	9538695	CATTCATT  CATT 
   one record with a mix of both repeat types
   20	9538695	TATTCATTCATT  CATT 

Representation of close by variants

    a single complex variant
    CHROM POS         REF   ALT
    1     124001690   C     AAA
    an Indel and SNP adjacent to one another
    CHROM POS         REF   ALT
    1     124001689   T     TAA
    1     124001690   C     A

Representing it as a single complex variant enforces that both "indel" and "SNP" are always together. Representing it as 2 separate variants allows both alleles to segregate independently.


This is the annotated output of peek in the vt suite.

stats:no. of samples                     :          0 #number of genotype fields in VCF file, this is a site list so it is 0
      no. of chromosomes                 :         25 #no. of chromosomes observed in this file.
========== Micro variants ==========
no. of SNP  : 54247827 #total number of SNPs 2 alleles  : 53487808 (1.99) [35616038/17871770] #ts/tv ratio and the respective counts 3 alleles  : 389190 (0.60) [291224/487156] 4 alleles  : 370828 (0.50) [370828/741656] >=5 alleles  : 1 (0.33) [1/3]
no. of MNP  : 122125 2 alleles  : 121849 (1.56) [152383/97816] 3 alleles  : 273 (0.89) [537/601] 4 alleles  : 3 (1.00) [9/9]
no. of Indel  : 6600770 #also referred to as simple Indels 2 alleles  : 6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts 3 alleles  : 280892 (8.72) [503977/57807] 4 alleles  : 28245 (131.19) [84094/641] >=5 alleles  : 5772 (3847.00) [23082/6]
no. of SNP/MNP  : 1161 3 alleles  : 1143 (1.57) [1565/994] 4 alleles  : 15 (1.36) [34/25] >=5 alleles  : 3 (0.67) [8/12]
no. of SNP/Indel  : 115153 2 alleles  : 42717 (0.65) [16778/25939] (0.57) [15441/27276] #ts/tv and ins/del ratios 3 alleles  : 66401 (0.72) [29681/41397] (0.33) [31458/96168] 4 alleles  : 4631 (0.55) [2420/4386] (0.25) [2602/10306] >=5 alleles  : 1404 (0.62) [1197/1926] (0.10) [513/4989]
no. of MNP/Indel  : 15619 2 alleles  : 12820 (0.51) [12099/23648] (0.77) [5594/7226] 3 alleles  : 2455 (0.40) [1796/4469] (0.45) [1144/2546] 4 alleles  : 292 (0.24) [215/891] (1.42) [415/292] >=5 alleles  : 52 (0.43) [96/225] (2.47) [126/51]
no. of SNP/MNP/Indel  : 273 3 alleles  : 167 (0.63) [201/321] (0.38) [70/184] 4 alleles  : 85 (0.35) [71/203] (0.28) [31/111] >=5 alleles  : 21 (0.35) [24/68] (0.68) [25/37]
no. of MNP/Clumped  : 61175 2 alleles  : 60617 (1.68) [84410/50220] 3 alleles  : 549 (1.23) [1777/1449] 4 alleles  : 8 (1.43) [53/37] >=5 alleles  : 1 (1.00) [5/5]
no. of SNP/MNP/Clumped  : 290 3 alleles  : 282 (1.35) [665/494] 4 alleles  : 8 (0.57) [13/23]
no. of Indel/Clumped  : 27638 2 alleles  : 25971 (0.65) [31435/48526] (0.79) [11444/14527] 3 alleles  : 1585 (0.74) [3568/4793] (0.87) [1383/1582] 4 alleles  : 70 (0.55) [96/175] (1.61) [124/77] >=5 alleles  : 12 (0.59) [37/63] (4.71) [33/7]
no. of SNP/Indel/Clumped  : 456 3 alleles  : 257 (0.84) [332/394] (0.33) [111/340] 4 alleles  : 174 (0.38) [105/279] (0.58) [186/321] >=5 alleles  : 25 (0.19) [12/63] (0.94) [44/47]
no. of MNP/Indel/Clumped  : 153 3 alleles  : 138 (0.50) [233/466] (0.84) [102/122] 4 alleles  : 12 (0.35) [14/40] (1.42) [17/12] >=5 alleles  : 3 (0.64) [7/11] (0.67) [4/6]
no. of SNP/MNP/Indel/Clumped  : 6 4 alleles  : 1 (3.00) [3/1] (0.00) [0/3] >=5 alleles  : 5 (0.62) [8/13] (2.00) [12/6]
no. of Reference  : 0
====== Other useful categories =====
no. of Block Substitutions  : 184751 #equivalent to categories with allele lengths that are the same. 2 alleles  : 182466 (1.60) [236793/148036] 3 alleles  : 2247 (1.28) [4544/3538] 4 alleles  : 34 (1.16) [109/94] >=5 alleles  : 4 (0.76) [13/17]
no. of Complex Substitutions  : 159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels 2 alleles  : 81508 (0.61) [60312/98113] (0.66) [32479/49029] 3 alleles  : 71003 (0.69) [35811/51840] (0.34) [34268/100942] 4 alleles  : 5265 (0.49) [2924/5975] (0.30) [3375/11122] >=5 alleles  : 1522 (0.58) [1381/2369] (0.15) [757/5143]
======= Structural variants ========
no. of structural variants  : 41217 2 alleles  : 38079 deletion  : 13135 insertion  : 16451 mobile element  : 16253 ALU  : 12513 LINE1  : 2911 SVA  : 829 numt  : 198 duplication  : 664 inversion  : 100 copy number variation  : 7729 >=3 alleles  : 3138 copy number variation  : 3138
========= General summary ==========
no. of observed variants  : 79449759 no. of unclassified variants  : 0


This is implemented in vt.

Maintained by

This page is maintained by Adrian.