Variant classification

Introduction

The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.

On this wiki page, we describe a a variant classification system for VCF entries that is invariant to normalization except for the case of MNPs.

Definitions

The definition of a variant is based on the definition of each allele with respect to the reference sequence. We consider 5 major types loosely decribed as follows.

1. SNP

The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.

2. MNP

The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.

OR

All reference and alternate sequences have the same length (this is applicable to all alleles).

3. INDEL

The reference and alternate sequences are not of the same length.

4. CLUMPED

A clumping of nearby SNPs, MNPs or Indels.

5. SV

The alternate sequence is represented by an angled bracket tag.

Classification Procedure

1. Trim each allele with respect to the reference sequence individually
2. Inspect length, defined as length of alternate allele minus length of reference allele.
   1. if length = 0
      1. if length(ref) = 1 and nucleotides differ, classify as SNP (count ts and tv too)
      2. if length(ref) > 1
         1. if all nucleotides differ, classify as MNP (count ts and tv too)
         2. if not all nucleotides differ, classify as CLUMPED (count ts and tv too)
   2. if length $\neq$ 0, classify as INDEL
      1. if shorter allele is of length 1
         1. if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification
      2. if shorter allele length > 1
         1. compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)
            1. if all nucleotides differ, add MNP classification
            2. if not all nucleotides differ, add CLUMPED classification
3. Variant classification is the union of the classifications of each allele present in the variant.
4. If all alleles are the same length, add MNP classification.

Examples

We present the following examples to explain the classification described.

Legend for examples

   <variant classification>

   REF <reference sequence>      
   ALT <alternative sequence 1>      #<allele classification>, <contribution to transition, transversion, insertion or deletion count>   
   ALT <alternative sequence 2>      #<allele classification>, <contribution to transition, transversion, insertion or deletion count>

Simple Biallelic Examples

   SNP

   REF  A       
   ALT  G     #SNP, 1 ts  

   MNP

   REF  AT     
   ALT  GC    #MNP, 2 ts

   INDEL

   REF  AT      
   ALT  A     #INDEL, 1 del

   INDEL

   REF  AT      
   ALT  T     #INDEL, 1 del
              #Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base.  
              #If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles.
              #Simple Indel classification should be invariant whether it is left or right aligned.

   SV

   REF  A    
   ALT <DEL>  #SV

Complex Biallelic Examples

   SNP|INDEL

   REF  AT           
   ALT  G           #SNP, INDEL, 1 ts
                    #Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually
                    #not defined.  In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which
                    #is a transversion.  In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition
                    #and transversion contribution.  But please be very clear that this is an ambiguous case.  It is better to consider this simply
                    #as a complex variant.

   MNP|INDEL

   REF  ATT          
   ALT  GG          #MNP, INDEL, 1 ts, 1 tv, 1 del

   MNP|CLUMPED

   REF  ATTTT        
   ALT  GTTTC       #MNP, CLUMPED, 2 ts
                    #since all the alleles are of the same length, classified as MNP too.

   INDEL|CLUMPED

   REF  ATTTTTTTT    
   ALT  GTTTC       #INDEL, CLUMPED, 2 ts, 1 del

Simple Multiallelic Examples

   SNP

   REF  A       
   ALT  G           #SNP, 1 ts
   ALT  C           #SNP, 1 tv

   MNP

   REF  AG      
   ALT  GC          #MNP, 1 ts, 1 tv
   ALT  CT          #MNP, 2 tv 

   INDEL

   REF  ATTT    
   ALT  ATT         #INDEL, 1 del
   ALT  ATTTT       #INDEL, 1 ins

Complex Multiallelic Examples

   SNP|MNP

   REF  AT    
   ALT  GT          #SNP, 1 ts
   ALT  AC          #SNP, 1 ts
                    #since all the alleles are of the sample length, classified as MNP too.

   SNP|MNP|CLUMPED

   REF  ATTTG    
   ALT  GTTTC       #CLUMPED, 1 ts, 1 tv
   ALT  ATTTC       #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP
                    #since all the alleles are of the sample length, classified as MNP too.

   SNP|MNP|INDEL

   REF  GT    
   ALT  CT          #SNP, 1 tv
   ALT  AG          #MNP, 2 tv
   ALT  GTT         #INDEL, 1 ins

   SNP|MNP|INDEL|CLUMPED

   REF  GTTT    
   ALT  CG          #MNP, INDEL, 2 tv, 1 del
   ALT  AG          #MNP, INDEL, 1 ts, 1 tv
   ALT  GTGTG       #SNP, INDEL, CLUMPED, 1 tv, 1 ins

Structured Variants Examples

   SV

   REF  G    
   ALT <INS:ME:LINE1>    #SV
   
   SV

   REF  G    
   ALT <CN4>             #SV
   ALT <CN12>            #SV

Interesting Variant Types

   Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. 

   

   20	9538655		ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTCATTCATTCATTCATTCATTCATTC 	<STR>

   This can be induced as
   
   one record considering only the ATTT repeats
   20	9538655	ATTTATTTATTT  ATTT 

   one record with CATT repeats
   20	9538695	CATTCATT  CATT 

   one record with a mix of both repeat types
   20	9538695	TATTCATTCATT  CATT 

Representation of close by variants

    1:124001690
    TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG
    TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG

    a single complex variant
    CHROM POS         REF   ALT
    1     124001690   C     AAA

    an Indel and SNP adjacent to one another
    CHROM POS         REF   ALT
    1     124001689   T     TAA
    1     124001690   C     A

Representing it as a single complex variant enforces that both "indel" and "SNP" are always together. Representing it as 2 separate variants allows both alleles to segregate independently.

Output

This is the annotated output of peek in the vt suite.

stats:no. of samples                     :          0 #number of genotype fields in VCF file, this is a site list so it is 0
      no. of chromosomes                 :         25 #no. of chromosomes observed in this file.
     
      ========== Micro variants ========== 

      no. of SNP                         :   54247827 #total number of SNPs
          2 alleles                      :        53487808 (1.99) [35616038/17871770] #ts/tv ratio and the respective counts
          3 alleles                      :          389190 (0.60) [291224/487156] 
          4 alleles                      :          370828 (0.50) [370828/741656] 
          >=5 alleles                    :               1 (0.33) [1/3]  

      no. of MNP                         :     122125
          2 alleles                      :          121849 (1.56) [152383/97816] 
          3 alleles                      :             273 (0.89) [537/601]
          4 alleles                      :               3 (1.00) [9/9] 

      no. of Indel                       :    6600770    #also referred to as simple Indels
          2 alleles                      :         6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts
          3 alleles                      :          280892 (8.72) [503977/57807]
          4 alleles                      :           28245 (131.19) [84094/641]
          >=5 alleles                    :            5772 (3847.00) [23082/6] 

      no. of SNP/MNP                     :       1161
          3 alleles                      :            1143 (1.57) [1565/994] 
          4 alleles                      :              15 (1.36) [34/25] 
          >=5 alleles                    :               3 (0.67) [8/12] 

      no. of SNP/Indel                   :     115153
          2 alleles                      :           42717 (0.65) [16778/25939] (0.57) [15441/27276]  #ts/tv and ins/del ratios 
          3 alleles                      :           66401 (0.72) [29681/41397] (0.33) [31458/96168]
          4 alleles                      :            4631 (0.55) [2420/4386] (0.25) [2602/10306]
          >=5 alleles                    :            1404 (0.62) [1197/1926] (0.10) [513/4989] 

      no. of MNP/Indel                   :      15619
          2 alleles                      :           12820 (0.51) [12099/23648] (0.77) [5594/7226]
          3 alleles                      :            2455 (0.40) [1796/4469] (0.45) [1144/2546]
          4 alleles                      :             292 (0.24) [215/891] (1.42) [415/292]
          >=5 alleles                    :              52 (0.43) [96/225] (2.47) [126/51] 

      no. of SNP/MNP/Indel               :        273
          3 alleles                      :             167 (0.63) [201/321] (0.38) [70/184]
          4 alleles                      :              85 (0.35) [71/203] (0.28) [31/111]
          >=5 alleles                    :              21 (0.35) [24/68] (0.68) [25/37]

      no. of MNP/Clumped                 :      61175
          2 alleles                      :           60617 (1.68) [84410/50220]
          3 alleles                      :             549 (1.23) [1777/1449] 
          4 alleles                      :               8 (1.43) [53/37] 
          >=5 alleles                    :               1 (1.00) [5/5]  

      no. of SNP/MNP/Clumped             :        290
          3 alleles                      :             282 (1.35) [665/494] 
          4 alleles                      :               8 (0.57) [13/23] 

      no. of Indel/Clumped               :      27638
          2 alleles                      :           25971 (0.65) [31435/48526] (0.79) [11444/14527]
          3 alleles                      :            1585 (0.74) [3568/4793] (0.87) [1383/1582]
          4 alleles                      :              70 (0.55) [96/175] (1.61) [124/77]
          >=5 alleles                    :              12 (0.59) [37/63] (4.71) [33/7] 

      no. of SNP/Indel/Clumped           :        456
          3 alleles                      :             257 (0.84) [332/394] (0.33) [111/340]
          4 alleles                      :             174 (0.38) [105/279] (0.58) [186/321]
          >=5 alleles                    :              25 (0.19) [12/63] (0.94) [44/47] 

      no. of MNP/Indel/Clumped           :        153
          3 alleles                      :             138 (0.50) [233/466] (0.84) [102/122]
          4 alleles                      :              12 (0.35) [14/40] (1.42) [17/12]
          >=5 alleles                    :               3 (0.64) [7/11] (0.67) [4/6] 

      no. of SNP/MNP/Indel/Clumped       :          6
          4 alleles                      :               1 (3.00) [3/1] (0.00) [0/3]
          >=5 alleles                    :               5 (0.62) [8/13] (2.00) [12/6] 

      no. of Reference                   :          0 

      ====== Other useful categories ===== 

      no. of Block Substitutions         :     184751 #equivalent to categories with allele lengths that are the same. 
          2 alleles                      :          182466 (1.60) [236793/148036] 
          3 alleles                      :            2247 (1.28) [4544/3538] 
          4 alleles                      :              34 (1.16) [109/94] 
          >=5 alleles                    :               4 (0.76) [13/17]  

      no. of Complex Substitutions       :     159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels
          2 alleles                      :           81508 (0.61) [60312/98113] (0.66) [32479/49029]
          3 alleles                      :           71003 (0.69) [35811/51840] (0.34) [34268/100942]
          4 alleles                      :            5265 (0.49) [2924/5975] (0.30) [3375/11122]
          >=5 alleles                    :            1522 (0.58) [1381/2369] (0.15) [757/5143] 

      ======= Structural variants ========

      no. of structural variants         :      41217
          2 alleles                      :           38079
              deletion                   :                13135
              insertion                  :                16451
                 mobile element          :                    16253
                    ALU                  :                        12513
                    LINE1                :                         2911
                    SVA                  :                          829
                 numt                    :                      198
              duplication                :                  664
              inversion                  :                  100
              copy number variation      :                 7729
          >=3 alleles                    :            3138
              copy number variation      :                 3138 

      ========= General summary ========== 

      no. of observed variants           :   79449759
      no. of unclassified variants       :          0

Implementation

This is implemented in vt.

Maintained by

This page is maintained by Adrian.