Changes

From Genome Analysis Wiki
Jump to navigationJump to search
Line 179: Line 179:  
     TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
 
     TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
   −
     HaplotypeCaller - a single complex variant
+
     a single complex variant
     CHROM POS       REF  ALT
+
     CHROM POS         REF  ALT
     1    124001690   C       AAA
+
     1    124001690   C     AAA
   −
     vt - an Indel and SNP adjacent to one another
+
     an Indel and SNP adjacent to one another
     CHROM POS       REF  ALT
+
     CHROM POS         REF  ALT
     1    124001689   T       TAA
+
     1    124001689   T     TAA
     1    124001690   C       A
+
     1    124001690   C     A
 +
 
 +
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together.
 +
Representing it as 2 separate variants allows both alleles to segregate independently.
    
= Output  =
 
= Output  =
1,102

edits

Navigation menu