Changes

From Genome Analysis Wiki
Jump to navigationJump to search

Variant classification (view source)

Revision as of 21:44, 25 February 2016

167 bytes added ,  21:44, 25 February 2016
→‎Representation of close by variants
Line 179: Line 179:  
     TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
 
     TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
   −
     HaplotypeCaller - a single complex variant
+
     a single complex variant
 
     CHROM POS        REF  ALT
 
     CHROM POS        REF  ALT
 
     1    124001690  C    AAA
 
     1    124001690  C    AAA
   −
     vt - an Indel and SNP adjacent to one another
+
     an Indel and SNP adjacent to one another
 
     CHROM POS        REF  ALT
 
     CHROM POS        REF  ALT
 
     1    124001689  T    TAA
 
     1    124001689  T    TAA
 
     1    124001690  C    A
 
     1    124001690  C    A
 +
 +
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together.
 +
Representing it as 2 separate variants allows both alleles to segregate independently.
    
= Output  =
 
= Output  =
Atks
1,102

edits

Retrieved from "http://genome.sph.umich.edu/wiki/Special:MobileDiff/14115"

Navigation menu