From Genome Analysis Wiki
Jump to navigationJump to search
68 bytes added
, 21:12, 25 February 2016
Line 172: |
Line 172: |
| one record with a mix of both repeat types | | one record with a mix of both repeat types |
| 20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span> | | 20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span> |
| + | |
| + | = Representation of close by variants = |
| + | |
| + | CATACTATATATAGCCTCCA |
| | | |
| = Output = | | = Output = |