Difference between revisions of "Vt"

From Genome Analysis Wiki
Jump to navigationJump to search
 
(133 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
= Introduction =
 
= Introduction =
  
vt is a variant tool set that discovers short variants from Next Generation Sequencing data.  The features are being rolled out to github as major rewriting is being undertaken.
+
vt is a variant tool set that discovers short variants from Next Generation Sequencing data.
  
 
= Installation =
 
= Installation =
 +
 +
== General ==
  
 
The source files are housed in github.  [https://github.com/samtools/htslib htslib] is  
 
The source files are housed in github.  [https://github.com/samtools/htslib htslib] is  
Line 15: Line 17:
 
   #change directory to vt
 
   #change directory to vt
 
   2. cd vt <br>
 
   2. cd vt <br>
 +
  #update submodules
 +
  3. git submodule update --init --recursive <br>
 
   #run make, note that compilers need to support the c++0x standard  
 
   #run make, note that compilers need to support the c++0x standard  
   3. make <br>
+
   4. make <br>
   #you can test the build (Acknowledgements to [https://github.com/holtgrewe holtgrewe@github] for helping out with this.)
+
   #you can test the build
   4. make test
+
  5. make test
 +
  <div class=" mw-collapsible mw-collapsed">
 +
  An expected output when all is well for the tests is shown here. (click expand =>)
 +
  <div class="mw-collapsible-content">
 +
  user@server:~/vt$ make test
 +
  test/test.sh
 +
  ++++++++++++++++++++++
 +
  Tests for vt normalize
 +
  ++++++++++++++++++++++
 +
  testing normalize
 +
              output VCF file : ok
 +
              output logs    : ok
 +
  +++++++++++++++++++++++++++++++
 +
  Tests for vt decompose_blocksub
 +
  +++++++++++++++++++++++++++++++
 +
  testing decompose_blocksub of even-length blocks
 +
              output VCF file : ok
 +
              output logs    : ok
 +
  testing decompose_blocksub with alignment
 +
              output VCF file : ok
 +
              output logs    : ok
 +
  testing decompose_blocksub of phased even-length blocks
 +
              output VCF file : ok
 +
              output logs    : ok
 +
  ++++++++++++++++++++++
 +
  Tests for vt decompose
 +
  ++++++++++++++++++++++
 +
  testing decompose for a triallelic variant
 +
              output VCF file : ok
 +
              output logs    : ok <br>
 +
  Passed tests : 5 / 5
 +
  </div>
 +
   </div>
  
Building has been tested on Linux and Mac systems on gcc 4.8.1 and clang 3.4.
+
=== Mac ===
 +
 
 +
You may install vt via homebrew.
 +
 
 +
  brew tap brewsci/bio
 +
  brew tap brewsci/science
 +
 
 +
  brew install brewsci/bio/vt
 +
 
 +
 
 +
Building has been tested on Linux and Mac systems on gcc 4.8.1 and clang 3.4. <br>
 +
Some features of C++11 are used, thus there is a need for newer versions of gcc and clang.
  
 
= Updating =
 
= Updating =
Line 34: Line 81:
 
   3. make -j 40
 
   3. make -j 40
  
= General Features =
+
= General Features and notes =
  
 
== Common options ==
 
== Common options ==
Line 43: Line 90:
  
 
     -o  defines the out file which and has the STDOUT set as the default.
 
     -o  defines the out file which and has the STDOUT set as the default.
 +
        vt recognizes the appropriate output by file extension.
 +
        <name>.vcf    - uncompressed VCF
 +
        <name>.vcf.gz  - compressed VCF
 +
        <name>.bcf    - BCF
 
         You may modify the STDOUT to output the binary version of the format.  Uncompressed
 
         You may modify the STDOUT to output the binary version of the format.  Uncompressed
         VCF and BCF streams are indicated by - and + respectively.
+
         VCF and BCF streams are indicated by - and + respectively.
  
 
     -f  filter expression
 
     -f  filter expression
Line 74: Line 125:
 
   This allows you to only analyse biallelic indels that are passed on chromosome 20.
 
   This allows you to only analyse biallelic indels that are passed on chromosome 20.
 
   vt profile_na12878 vt.bcf -g na12878.reference.txt -r genome.fa -f "N_ALLELE==2&&VTYPE==INDEL&&PASS"  -i 20
 
   vt profile_na12878 vt.bcf -g na12878.reference.txt -r genome.fa -f "N_ALLELE==2&&VTYPE==INDEL&&PASS"  -i 20
 +
 +
  This allows you to extract biallelic indels that are passed on chromosome 20.
 +
  vt view vt.bcf -f "N_ALLELE==2&&VTYPE==INDEL&&PASS"  -i 20
  
 
Other examples of filters
 
Other examples of filters
Line 85: Line 139:
  
 
   Variant characteristics
 
   Variant characteristics
     VTYPE,N_ALLELE,DLEN,LEN
+
     VTYPE,N_ALLELE,DLEN,LEN,VARIANT_CONTAINS_N
  
 
   Variant value types
 
   Variant value types
 
     SNP,MNP,INDEL,CLUMPED
 
     SNP,MNP,INDEL,CLUMPED
  
   Biallelic SNPs only                       : VTYPE==SNP&&N_ALLELE==2
+
   Biallelic SNPs only                         : VTYPE==SNP&&N_ALLELE==2
   Biallelic Indels with embedded SNP       : VTYPE==(SNP|INDEL)&&N_ALLELE==2
+
   Biallelic Indels with embedded SNP         : VTYPE==(SNP|INDEL)&&N_ALLELE==2
   Biallelic variants involving insertions   : VTYPE&INDEL&&DLEN>0&&N_ALLELE==2
+
   Biallelic variants involving insertions     : VTYPE&INDEL&&DLEN>0&&N_ALLELE==2
   Biallelic variants involving 1bp variants : LEN==1&&N_ALLELE==2
+
   Biallelic variants involving 1bp variants   : LEN==1&&N_ALLELE==2
 +
  Variants with explicit sequences with no Ns : ~VARIANT_CONTAINS_N
 +
 
 +
  REF field
 +
    REF
 +
 
 +
  ALT field
 +
    ALT
  
 
   QUAL field
 
   QUAL field
Line 103: Line 164:
 
   INFO fields
 
   INFO fields
 
     INFO.<tag>
 
     INFO.<tag>
 
+
 
 +
  A/C SNPs                                    : REF=='A' && ALT=='C'
 +
  AC type of STRs                            : REF=~'^.(AC)+$' || ALT=~'^.(AC)+$'
 
   Passed biallelic SNPs only                  : PASS&&VTYPE==SNP&&N_ALLELE==2
 
   Passed biallelic SNPs only                  : PASS&&VTYPE==SNP&&N_ALLELE==2
 
   Passed Common biallelic SNPs only          : PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005
 
   Passed Common biallelic SNPs only          : PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005
Line 155: Line 218:
 
   well formed header.  Simply provide a header file stub named as <vcf-file>.hdr and vt
 
   well formed header.  Simply provide a header file stub named as <vcf-file>.hdr and vt
 
   will automatically read it instead of the original header in <vcf-file>.
 
   will automatically read it instead of the original header in <vcf-file>.
 +
 +
  For more information about VCF/BCF : http://samtools.github.io/hts-specs/VCFv4.2.pdf
  
 
   <span style="color:#FF0000">This mechanism is available only if one is reading VCF or compressed VCF files.  It is
 
   <span style="color:#FF0000">This mechanism is available only if one is reading VCF or compressed VCF files.  It is
Line 167: Line 232:
 
   I am trying to make vt handle [http://genome.sph.umich.edu/wiki/Relationship_between_Ploidy,_Alleles_and_Genotypes general cases of ploidy and alleles].   
 
   I am trying to make vt handle [http://genome.sph.umich.edu/wiki/Relationship_between_Ploidy,_Alleles_and_Genotypes general cases of ploidy and alleles].   
 
   Please let me know if that is lacking in a tool that you are using.
 
   Please let me know if that is lacking in a tool that you are using.
 +
 +
== BCF Compression Levels vs Compression Time ==
 +
 +
The zlib deflation algorithm (a variant of LZ77) has 10 levels - 0 to 9.  0 has no compression but instead wraps <br>
 +
up the file in zlib or bgzf blocks.  It may be useful to have 0 compression as it is indexable with the same mechanism <br>
 +
used for compressed files.  Levels 1-9 denote an increasing compression level in exchange for longer times for <br>
 +
compression.
 +
 +
In general, zlib compression does not have significant differences in compression for BCF files between the 9 compression <br>
 +
levels as shown in the following table:
 +
 +
{| class="wikitable"
 +
|-
 +
! scope="col"| Compression Level
 +
! scope="col"| Size
 +
! scope="col"| Time
 +
|-
 +
|0<br>
 +
1<br>
 +
2<br>
 +
3<br>
 +
4<br>
 +
5<br>
 +
6 (default) <br>
 +
7<br>
 +
8<br>
 +
9
 +
|153GB <br>
 +
98.4GB <br>
 +
98.0GB <br>
 +
97.5GB <br>
 +
95.5GB <br>
 +
95.2GB <br>
 +
94.9GB <br>
 +
94.8GB <br>
 +
94.76GB <br>
 +
94.75GB
 +
|45m<br>
 +
2h3m <br>
 +
2h7m <br>
 +
2h12m <br>
 +
2h26m <br>
 +
2h54m <br>
 +
3h19m <br>
 +
3h41m <br>
 +
4h5m <br>
 +
4h25m
 +
|}
 +
 +
<span style="color:#0000FF">So, it might be a good idea to compress at lower levels when dealing with large temporary <br>
 +
files in a pipeline to save compute time.  This can be achieved with the -c option in vt view</span>
  
 
= VCF Manipulation =
 
= VCF Manipulation =
Line 178: Line 294:
 
   #views mills.bcf and outputs to standard out
 
   #views mills.bcf and outputs to standard out
 
   vt view -h mills.bcf  
 
   vt view -h mills.bcf  
   #views mills.bcf and locally sorts it in a 10000bp window and outputs to out.bcf
+
 
   vt view -h -w 10000 mills.bcf  
+
   #views mills.bcf and locally sorts it in a 10000bp window and outputs to sorted-millsbcf
 +
  vt view -h -w 10000 mills.bcf -o sorted-mills.bcf
 +
 
 +
  #views mills.bcf and outputs to c1-mills.bcf with a compression level of 1.  By default,
 +
  #the compression level is 6 where lower levels compress the file less but are faster.
 +
  #The difference in compression for BCF files between level 1 to level 9 is about 5% of
 +
  #of a level 1 compression file.  The difference in time taken is about an additional 50%
 +
  #of a level 1 compression.  The levels range from 0 to 9 where 0 means no compression
 +
  #but the file is encapsulated in bgzf blocks that allows the file to be indexed.  A special
 +
  #level -1 denotes an uncompressed BCF file that is not encapsulated in bgzf blocks and
 +
  #are thus not indexable but are highly suitable for streaming between vt commands.
 +
   vt view -h mills.bcf -c 1 -o c1-mills.bcf
 +
 
 +
  #views mills.bcf and selects variants that overlap with the regions found in dust.bed from chromosome 20
 +
  #the -t option selects variants by checking if each variant overlaps with the regions in the bed file, this is
 +
  #as opposed to random accessing the variants via the index through the intervals defined in -i and -I options.
 +
  #this is useful when selecting variants from the target regions from an exome sequencing experiment.
 +
  vt view 10000 mills.bcf -t dust.bed -i 20
  
 
<div class="mw-collapsible-content">
 
<div class="mw-collapsible-content">
Line 185: Line 318:
  
 
   options : -o  output VCF/VCF.GZ/BCF file [-]
 
   options : -o  output VCF/VCF.GZ/BCF file [-]
 +
            -f  filter expression []
 
             -w  local sorting window size [0]
 
             -w  local sorting window size [0]
 
             -s  print site information only without genotypes [false]
 
             -s  print site information only without genotypes [false]
             -h  print header [false]
+
            -H  print header only, this option is honored only for STDOUT [false]
 +
             -h  omit header, this option is honored only for STDOUT [false]
 
             -p  print options and summary []
 
             -p  print options and summary []
 +
            -r  right window size for overlap []
 +
            -l  left window size for overlap []
 +
            -c  compression level 0-9, 0 and -1 denotes uncompressed with the former being wrapped in bgzf. [6]
 +
            -t  bed file for variant selection via streaming []
 
             -I  file containing list of intervals []
 
             -I  file containing list of intervals []
 
             -i  intervals []
 
             -i  intervals []
Line 196: Line 335:
  
 
=== Index ===
 
=== Index ===
 
  
 
Indexes a VCF.GZ or BCF file.
 
Indexes a VCF.GZ or BCF file.
Line 273: Line 411:
 
   #normalize variants, send to standard out and remove duplicates.
 
   #normalize variants, send to standard out and remove duplicates.
 
   vt normalize dbsnp.vcf -r seq.fa | vt uniq - -o dbsnp.normalized.uniq.vcf
 
   vt normalize dbsnp.vcf -r seq.fa | vt uniq - -o dbsnp.normalized.uniq.vcf
 +
 +
  #read in variants that do not contain N in the explicit alleles, normalize variants, send to standard out.
 +
  vt normalize dbsnp.vcf -r seq.fa -f "~VARIANT_CONTAINS_N"
  
 
   #variants that are normalized will be annotated with an OLD_VARIANT info tag.
 
   #variants that are normalized will be annotated with an OLD_VARIANT info tag.
Line 304: Line 445:
 
             -d  debug [false]
 
             -d  debug [false]
 
             -q  do not print options and summary [false]
 
             -q  do not print options and summary [false]
             -n  do not fail when REF is inconsistent with reference sequence for non SNPs [false]
+
            -m  warns but does not exit when REF is inconsistent
 +
                with masked reference sequence for non SNPs.
 +
                This overides the -n option [false]
 +
             -n  warns but does not exit when REF is inconsistent
 +
                with reference sequence for non SNPs [false]
 
             -w  window size for local sorting of variants [10000]
 
             -w  window size for local sorting of variants [10000]
 
             -I  file containing list of intervals []
 
             -I  file containing list of intervals []
Line 319: Line 464:
 
There is now an additional option -a which decomposes non block substitutions into its constituent SNPs and indels. (kindly added by [[https://github.com/holtgrewe holtgrewe@github]]) <br>
 
There is now an additional option -a which decomposes non block substitutions into its constituent SNPs and indels. (kindly added by [[https://github.com/holtgrewe holtgrewe@github]]) <br>
 
There is no exact solution and this decomposition is based on the best guess outcome using a Needleman-Wunsch algorithm. <br>
 
There is no exact solution and this decomposition is based on the best guess outcome using a Needleman-Wunsch algorithm. <br>
todo: rename program?
+
You might also want to check out [https://github.com/vcflib/vcflib#vcfallelicprimitives vcfallelicprimitives]. <br>
 +
<br>
 +
There is now an additional option -m and -d which ensures that some MNVs are not decomposed. (kindly added by [[https://github.com/jaudoux jaudoux@github]]) <br>
 +
The motivation is from<br>
 +
*Exome-wide assessment of the functional impact and pathogenicity of multi-nucleotide mutations https://www.biorxiv.org/content/10.1101/258723v2.full<br>
 +
*Landscape of multi-nucleotide variants in 125,748 human exomes and 15,708 genomes https://www.biorxiv.org/content/10.1101/573378v2.full<br>
 
</div>
 
</div>
  
Line 342: Line 492:
 
   20   763837  . C T 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1
 
   20   763837  . C T 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1
 
   20   763838  . G GA 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1
 
   20   763838  . G GA 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1
 +
 +
  #decomposes biallelic clumped variant and write out to decomposed_blocksub.vcf and add phase set information in the genotype fields
 +
  vt decompose_blocksub -p gatk.vcf -o decomposed_blocksub.vcf <br>
 +
  #before decomposition
 +
  #CHROM  POS     ID   REF        ALT        QUAL FILTER INFO                                         FORMAT tumor     normal
 +
  1   159030    .   TAACCTTTC  TGACCTTTT  0.04 . AF=0.5                                         GT      0/0          1/1  <br>                                                             
 +
  #after decomposition
 +
  1   159031    .   A          G         0.04 . AF=0.5;OLD_CLUMPED=1:159030:TAACCTTTC/TGACCTTTT GT:PS 0|0:159031  1|1:159031
 +
  1   159038    .   C          T         0.04 . AF=0.5;OLD_CLUMPED=1:159030:TAACCTTTC/TGACCTTTT GT:PS 0|0:159031  1|1:159031
 
      
 
      
 
<div class="mw-collapsible-content">
 
<div class="mw-collapsible-content">
 
   description : decomposes biallelic block substitutions into its constituent SNPs. <br>
 
   description : decomposes biallelic block substitutions into its constituent SNPs. <br>
 
   usage : vt decompose_blocksub [options] <in.vcf> <br>
 
   usage : vt decompose_blocksub [options] <in.vcf> <br>
   options : -a  enable aggressive/alignment mode
+
   options : -m  keep MNVs (multi-nucleotide variants) [false]
 +
            -a  enable aggressive/alignment mode [false]
 +
            -d  MNVs max distance (when -m option is used) [2]
 
             -o  output VCF file [-]
 
             -o  output VCF file [-]
 
             -I  file containing list of intervals []
 
             -I  file containing list of intervals []
 
             -i  intervals []
 
             -i  intervals []
             -?  displays help
+
             -?  displays help-a  enable aggressive/alignment mode
 +
 
 
</div>
 
</div>
 
</div>
 
</div>
Line 411: Line 573:
 
=== Drop duplicate variants ===
 
=== Drop duplicate variants ===
  
Drops duplicate variants that appear later in the file.  <br>
+
Drops duplicate variants that appear later in the file.  VCF file must be ordered. <br>
 
If there are OLD_VARIANT tags in the INFO field, the variants in these tags are aggregated in the unique record retained.
 
If there are OLD_VARIANT tags in the INFO field, the variants in these tags are aggregated in the unique record retained.
  
Line 456: Line 618:
 
=== Concatenate ===
 
=== Concatenate ===
  
Concatenate VCF files.  Assumes individuals are in the same order and files share the same header.
+
Concatenates VCF files.  Assumes individuals are in the same order and files share the same header.
  
 
<div class=" mw-collapsible mw-collapsed">
 
<div class=" mw-collapsible mw-collapsed">
   #concatenate chr1.mills.bcf and chr2.mills.bcf
+
   #concatenates chr1.mills.bcf and chr2.mills.bcf
 
   vt cat chr1.mills.bcf chr2.mills.bcf -o mills.bcf
 
   vt cat chr1.mills.bcf chr2.mills.bcf -o mills.bcf
 +
 +
  #concatenates chr1.mills.bcf and chr2.mills.bcf with the naive option.
 +
  #The naive option assumes that the headers are all the same and skips
 +
  #merging headers and translating encodings between BCF files.  This is
 +
  #a much faster option if you know the nature of your BCF files in advance.
 +
  vt cat -n chr1.mills.bcf chr2.mills.bcf -o mills.bcf
  
 
<div class="mw-collapsible-content">
 
<div class="mw-collapsible-content">
Line 466: Line 634:
  
 
   options : -s  print site information only without genotypes [false]
 
   options : -s  print site information only without genotypes [false]
             -p  print options and summary []
+
             -p  print options and summary [false]
 +
            -n  naive, assumes that headers are the same. [false]
 +
            -w  local sorting window size [0]
 +
            -f  filter expression []
 
             -L  file containing list of input VCF files
 
             -L  file containing list of input VCF files
 
             -o  output VCF file [-]
 
             -o  output VCF file [-]
Line 492: Line 663:
 
             -i  intervals []
 
             -i  intervals []
 
             -?  displays help
 
             -?  displays help
 +
</div>
 +
</div>
 +
 +
=== Filter ===
 +
 +
Filters variants in a VCF file
 +
 +
<div class=" mw-collapsible mw-collapsed">
 +
  #adds a filter tag "refA" for variants where the REF column is a A sequence.
 +
  vt filter in.bcf -f "REF=='A'" -d "refA"
 +
 +
<div class="mw-collapsible-content">
 +
  usage : vt filter [options] <in.vcf> <br>
 +
  options : -x  clear filter [false]
 +
            -f  filter expression []
 +
            -d  filter tag description []
 +
            -t  filter tag []
 +
            -o  output VCF file [-]
 +
            -I  file containing list of intervals []
 +
            -i  intervals
 +
            -?  displays help </div>
 +
</div>
 +
 +
=== Filter overlap ===
 +
 +
Tags overlapping variants in a VCF file with the FILTER flag overlap.
 +
 +
<div class=" mw-collapsible mw-collapsed">
 +
  #adds a filter tag "overlap" for overlapping variants within a window size of 1 based on the REF sequence.
 +
  vt filter_overlap in.bcf -w 1 out.bcf
 +
 +
  todo: option for considering END info tag for detecting overlaps.
 +
 +
<div class="mw-collapsible-content">
 +
  usage : vt filter_overlap [options] <in.vcf>
 +
 
 +
  options : -o  output VCF file [-]
 +
            -w  window overlap for variants [0]
 +
            -I  file containing list of intervals []
 +
            -i  intervals []
 +
            -?  displays help
 
  </div>
 
  </div>
 
</div>
 
</div>
Line 512: Line 724:
 
             -i  intervals []
 
             -i  intervals []
 
             -r  reference sequence fasta file []
 
             -r  reference sequence fasta file []
 +
            -?  displays help
 +
</div>
 +
</div>
 +
 +
=== Extract INFO fields to a tab delimited file ===
 +
 +
Converts a VCF file and its shared information in the INFO field to a tab delimited file for further analysis.
 +
 +
<div class=" mw-collapsible mw-collapsed">
 +
  #converts in.bcf to tab format with selected INFO and FILTER fields
 +
  vt info2tab in.bcf -u PASS -t EX_RL,FZ_RL,MDUST,LOBSTR,VNTRSEEK,RMSK,EX_REPEAT_TRACT
 +
  <div style="height:6em; overflow:auto; border: 2px solid #FFF">
 +
  INPUT
 +
  =====
 +
  20 17548608 . A AC . PASS CENTERS=vbi;NCENTERS=1;OLD_MULTIALLELIC=20:17548598:GAAAAAAAAAAAAA/GAAAAAAAAAAAA/GAAAAAAAAAAAAAA/GAAAAAAAAAA/GAAAAAAAAAAA/GAAAAAAAAAACAAA;OLD_VARIANT=20:17548598:GAAAAAAAAAAAAAG/GAAAAAAAAAACAAAG;EX_MOTIF=C;EX_MLEN=1;EX_RU=C;EX_BASIS=C;EX_BLEN=1;EX_REPEAT_TRACT=17548608,17548609;EX_COMP=100,0,0,0;EX_ENTROPY=0;EX_ENTROPY2=0;EX_KL_DIVERGENCE=2;EX_KL_DIVERGENCE2=4;EX_REF=2;EX_RL=2;EX_LL=3;EX_RU_COUNTS=0,2;EX_SCORE=0;EX_TRF_SCORE=-14;FZ_MOTIF=A;FZ_MLEN=1;FZ_RU=A;FZ_BASIS=A;FZ_BLEN=1;FZ_REPEAT_TRACT=17548599,17548611;FZ_COMP=100,0,0,0;FZ_ENTROPY=0;FZ_ENTROPY2=0;FZ_KL_DIVERGENCE=2;FZ_KL_DIVERGENCE2=4;FZ_REF=13;FZ_RL=13;FZ_LL=14;FZ_RU_COUNTS=13,13;FZ_SCORE=1;FZ_TRF_SCORE=26;FLANKSEQ=GAAAAAAAAA[A]AAAGAAGGAA;MDUST;LOBSTR
 +
  20 17548608 . AAAAG A . PASS CENTERS=ox1;NCENTERS=1;EX_MOTIF=AAAG;EX_MLEN=4;EX_RU=AAAG;EX_BASIS=AG;EX_BLEN=2;EX_REPEAT_TRACT=17548609,17548612;EX_COMP=100,0,0,0;EX_ENTROPY=0;EX_ENTROPY2=0;EX_KL_DIVERGENCE=2;EX_KL_DIVERGENCE2=4;EX_REF=0.75;EX_RL=4;EX_LL=4;EX_RU_COUNTS=0,1;EX_SCORE=0.75;EX_TRF_SCORE=-1;FZ_MOTIF=A;FZ_MLEN=1;FZ_RU=A;FZ_BASIS=A;FZ_BLEN=1;FZ_REPEAT_TRACT=17548599,17548611;FZ_COMP=100,0,0,0;FZ_ENTROPY=0;FZ_ENTROPY2=0;FZ_KL_DIVERGENCE=2;FZ_KL_DIVERGENCE2=4;FZ_REF=13;FZ_RL=13;FZ_LL=13;FZ_RU_COUNTS=13,13;FZ_SCORE=1;FZ_TRF_SCORE=26;FLANKSEQ=GAAAAAAAAA[AAAAG]AAGGAACTAC;MDUST;LOBSTR;OLD_VARIANT=20:17548598:GAAAAAAAAAAAAAG/GAAAAAAAAAA
 +
  </div>
 +
  OUTPUT
 +
  ======
 +
  CHROM POS   REF   ALT N_ALLELE  PASS  EX_RL  FZ_RL MDUST LOBSTR VNTRSEEK  RMSK EX_REPEAT_TRACT_1 EX_REPEAT_TRACT_2
 +
  20 17548608  A   AC 2        1    2      13 1 1 0   0    17548608                17548608
 +
  20 17548608  AAAAG  A 2        1    4      13      1      1      0        0    17548609                17548609
 +
 +
<div class="mw-collapsible-content">
 +
  usage : vt info2tab [options] <in.vcf>
 +
 
 +
  options : -d  debug [false]
 +
            -f  filter expression []
 +
            -u  list of filter tags to be extracted []-t  list of info tags to be extracted []
 +
            -o  output tab delimited file [-]
 +
            -I  file containing list of intervals []
 +
            -i  intervals []
 
             -?  displays help
 
             -?  displays help
 
  </div>
 
  </div>
Line 739: Line 983:
  
 
Compute features in a VCF file.  Example of statistics are Allele counts, [[Genotype_Likelihood_based_Inbreeding_Coefficient|Genotype Likelihood based Inbreeding Coefficient]].
 
Compute features in a VCF file.  Example of statistics are Allele counts, [[Genotype_Likelihood_based_Inbreeding_Coefficient|Genotype Likelihood based Inbreeding Coefficient]].
[[Genotype_Likelihood_based_Allele_Frequency|Hardy-Weinberg Genotype Likelihood based Allele Frequencies]]
+
[[Genotype_Likelihood_based_Allele_Frequency|Hardy-Weinberg Genotype Likelihood based Allele Frequencies]] <br>
 +
For more customizable feature computation - look at [http://genome.sph.umich.edu/wiki/Vt#Estimate estimate]
  
 
<div class=" mw-collapsible mw-collapsed">
 
<div class=" mw-collapsible mw-collapsed">
Line 822: Line 1,067:
 
             -i  Intervals
 
             -i  Intervals
 
             -?  displays help
 
             -?  displays help
 +
</div>
 +
</div>
 +
 +
=== Profile Mendelian Errors ===
 +
 +
Profile Mendelian errors
 +
 +
<div class=" mw-collapsible mw-collapsed">
 +
  #profile mendelian errors found in vt.genotypes.bcf, generate [[media:mendel.pdf|tables]] in the directory mendel, requires pdflatex.
 +
  vt profile_mendelian vt.genotypes.bcf -p trios.ped -x mendel
 +
 +
  pedigree file format is described in [[Vt#Pedigree File|here]].
 +
 +
  #this is a sample output for mendelian error profiling.
 +
  #R and A stand for reference and alternate allele respectively.
 +
  #Error% - mendelian error (confounded with de novo mutation)
 +
  #HomHet - Homozygous-Heterozygous genotype ratios
 +
  #Het% - proportion of hets
 +
  Mendelian Errors <br>
 +
  Father Mother      R/R          R/A          A/A    Error(%) HomHet    Het(%)
 +
  R/R    R/R        14889          210          38    1.64      nan    nan
 +
  R/R    R/A        3403        3497          74    1.06      0.97  50.68
 +
  R/R    A/A          176        1482          155    18.26      nan    nan
 +
  R/A    R/R        3665        3652          68    0.92      1.00  49.91
 +
  R/A    R/A        1015        3151          990    0.00      0.64  61.11
 +
  R/A    A/A          43        1300        1401    1.57      1.08  48.13
 +
  A/A    R/R          172        1365          147    18.94      nan    nan
 +
  A/A    R/A          47        1164        1183    1.96      1.02  49.60
 +
  A/A    A/A          20          78        5637    1.71      nan    nan <br>
 +
  Parental            R/R          R/A          A/A    Error(%) HomHet    Het(%)
 +
  R/R    R/R        14889          210          38    1.64      nan    nan
 +
  R/R    R/A        7068        7149          142    0.99      0.99  50.28
 +
  R/R    A/A          348        2847          302    18.59      nan    nan
 +
  R/A    R/A        1015        3151          990    0.00      0.64  61.11
 +
  R/A    A/A          90        2464        2584    1.75      1.05  48.81
 +
  A/A    A/A          20          78        5637    1.71      nan    nan  <br>
 +
  Parental            R/R          R/A          A/A    Error(%) HomHet    Het(%)
 +
  HOM    HOM        14909          288        5675    1.66      nan    nan
 +
  HOM    HET        7158        9613        2726    1.19      1.00  49.90
 +
  HET    HET        1015        3151          990    0.00      0.64  61.11
 +
  HOMREF HOMALT      348        2847          302    18.59      nan    nan  <br>
 +
  total mendelian error :  2.505%
 +
  no. of trios    : 2
 +
  no. of variants  : 25346
 +
 
 +
<div class="mw-collapsible-content">
 +
profile_mendelian v0.5
 +
 +
  usage : vt profile_mendelian [options] <in.vcf>
 +
 +
  options : -q  minimum genotype quality
 +
            -d  minimum depth
 +
            -r  reference sequence fasta file []
 +
            -x  output latex directory []
 +
            -p  pedigree file
 +
            -I  file containing list of intervals []
 +
            -i  intervals
 +
          -?  displays help
 
  </div>
 
  </div>
 
</div>
 
</div>
Line 834: Line 1,137:
  
 
   #this is a sample output for indel profiling.
 
   #this is a sample output for indel profiling.
   # square brackets contain the ins/del ratio
+
   # square brackets contain the ts/tv ratio.   
  # for the FS/NFS field, that is the proportion of coding indels that are frame shifted.   
+
   # The numbers in curved bracket are the counts of ts and tv SNPs respectively.
   # The numbers in curved bracket are the counts of frame shift and non frame shift indels respectively.
+
  # Low complexity shows what percent of the SNPs are in low complexity regions.
 
   data set
 
   data set
 
     No. SNPs          :    508603 [2.09]
 
     No. SNPs          :    508603 [2.09]
        SYN/NONSYN    :      1.00 (4617/0)
 
 
         Low complexity :      0.08 (39837/508603) <br>
 
         Low complexity :      0.08 (39837/508603) <br>
 
   1000g
 
   1000g
Line 947: Line 1,249:
 
</div>
 
</div>
  
=== Profile Mendelian Errors ===
+
=== Profile VNTRs ===
  
Profile Mendelian errors
+
Profile VNTRs.  The reference data sets can be obtained from [[Vt#Resource_Bundle|vt resource bundle]].
  
 
<div class=" mw-collapsible mw-collapsed">
 
<div class=" mw-collapsible mw-collapsed">
  #profile mendelian errors found in vt.genotypes.bcf, generate [[media:mendel.pdf|tables]] in the directory mendel, requires pdflatex.
 
  vt profile_mendelian vt.genotypes.bcf -p trios.ped -x mendel
 
  
  #this is a sample output for mendelian error profiling.
+
  #profiles a set of VNTRs
  #R and A stand for reference and alternate allele respectively.
+
  vt profile_vntrs vntrs.sites.bcf -g vntr.reference.txt
  #Error% - mendelian error (confounded with de novo mutation)
+
 
  #HomHet - Homozygous-Heterozygous genotype ratios
+
 
  #Het% - proportion of hets
+
  profile_vntrs v0.5
  Mendelian Errors <br>
+
 
  Father Mother      R/R          R/A          A/A    Error(%) HomHet    Het(%)
+
    no VNTRs          5660874          #number of VNTRs in vntrs.sites.bcf
  R/R    R/R        14889          210          38     1.64      nan    nan
+
    no low complexity  2686460 (47.46%)  #number of VNTRs in low complexity region determined by MDUST
   R/R    R/A        3403        3497          74     1.06      0.97  50.68
+
    no coding          17911 (0.32%)     #number of VNTRs in coding regions determined by GENCODE v7
  R/R    A/A          176        1482          155    18.26      nan    nan
+
    no redundant      1312209 (23.18%)  #number of VNTRs involved in overlapping with one another<br>
  R/A   R/R        3665        3652          68     0.92      1.00  49.91
+
  trf_lobstr (1638516) #TRF based reference set used in lobSTR, motif lengths 1 to 6.
  R/A   R/A        1015        3151          990     0.00      0.64  61.11
+
     A-B    3269285    #TRs specific to vntrs.sites.bcf
  R/A   A/A          43        1300        1401     1.57      1.08  48.13
+
    A-B~   1666185     #TRs in vntrs.sites.bcf that overlap partially with at least one TR in TRF(lobSTR) but does not overlap exactly with another TR.
  A/A    R/R          172        1365          147    18.94      nan    nan
+
    A&B1    725404    #TRs in vntrs.sites.bcf that overlap exactly with at least one TR in TRF(lobSTR)
  A/A   R/A           47        1164        1183     1.96     1.02 49.60
+
    A&B2    723195     #TRs in TRF(lobSTR) that overlap exactly with at least one TR in vntrs.sites.bcf
  A/A   A/A           20          78        5637     1.71      nan    nan <br>
+
    B-A~    710075     #TRs in TRF(lobSTR) that overlap partially with at least one TR in vntrs.sites.bcf but does not overlap exactly with another TR.
  Parental            R/R         R/A          A/A    Error(%) HomHet    Het(%)
+
    B-A     205246     #TRs specific to TRF(lobSTR)
  R/R    R/R        14889          210           38    1.64      nan    nan
+
  #note that the first 3 rows should sum up to the number of TRs in vntrs.sites.bcf
  R/R    R/A         7068        7149          142    0.99      0.99 50.28
+
  #and the 4th to 6th rows should sum up to the number of TRs in TRF( lobSTR)
   R/R    A/A          348        2847          302    18.59      nan    nan
+
  #This basically allows us to see the m to n overlapping in overlapping TRs<br>
   R/A    R/A        1015        3151          990    0.00      0.64  61.11
+
  trf_repeatseq (1624553) #TRF based reference set used in repeatseq, motif lengths 1 to 6.
  R/A    A/A          90        2464        2584    1.75      1.05  48.81
+
    A-B    3291652
  A/A    A/A          20          78        5637    1.71      nan    nan  <br>
+
    A-B~   1650190
  Parental            R/R          R/A          A/A    Error(%) HomHet    Het(%)
+
    A&B1    719032
  HOM    HOM        14909          288        5675    1.66      nan    nan
+
    A&B2    716838
  HOM    HET        7158        9613        2726    1.19      1.00 49.90
+
    B-A~    703948
  HET    HET        1015        3151          990    0.00      0.64  61.11
+
     B-A     203767 <br>
  HOMREF HOMALT      348        2847          302    18.59      nan    nan  <br>
+
  trf_vntrseek (230306)  #TRF based reference set used in vntrseek, motif lengths 7 to 2000.
  total mendelian error :   2.505%
+
    A-B    5384453
  no. of trios    : 2
+
    A-B~    271302
  no. of variants  : 25346
+
    A&B1      5119
 +
    A&B2      4973
 +
    B-A~      92496
 +
     B-A      132837  <br>
 +
  codis+ (15)            #CODIS STRs + 2 STRs from PROMEGA
 +
    A-B    5660794
 +
    A-B~        79
 +
    A&B1         1
 +
    A&B2         1
 +
    B-A~        14
 +
    B-A           0
 +
 
 +
  # This file contains information on how to process reference data sets.
 +
  # dataset - name of data set, this label will be printed.
 +
  # type   - True Positives (TP) and False Positives (FP).
 +
  #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively.
 +
  #         - annotation.
 +
  #          file is used for GENCODE annotation of coding VNTRs.
 +
  # filter - filter applied to variants for this particular data set.
 +
  # path   - path of indexed BCF file.
 +
  #dataset      type            filter                      path
 +
  trf_lobstr   TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.lobstr.sites.bcf
 +
  trf_repeatseq TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.repeatseq.sites.bcf
 +
  trf_vntrseek  TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.vntrseek.sites.bcf
 +
  codis+        TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/codis.strs.sites.bcf
 +
  GENCODE_V19  cds_annotation .                           /net/fantasia/home/atks/ref/vt/grch37/gencode.v19.cds.bed.gz
 +
   DUST          cplx_annotation .                            
  
 
<div class="mw-collapsible-content">
 
<div class="mw-collapsible-content">
profile_mendelian v0.5
+
  usage : vt profile_vntrs [options] <in.vcf>
  
   usage : vt profile_mendelian [options] <in.vcf>
+
   options : -g  file containing list of reference datasets []
 
+
            -I file containing list of intervals []
  options : -q minimum genotype quality
+
             -i intervals []
             -d minimum depth
 
 
             -r  reference sequence fasta file []
 
             -r  reference sequence fasta file []
             -x  output latex directory []
+
             -?  displays help
            -p  pedigree file
 
            -I  file containing list of intervals []
 
            -i  intervals
 
          -?  displays help
 
 
  </div>
 
  </div>
 
</div>
 
</div>
Line 1,080: Line 1,401:
  
 
=== Discover ===
 
=== Discover ===
 
 
Discovers variants from reads in a BAM file.
 
 
<div class=" mw-collapsible mw-collapsed">
 
  #discover variants from NA12878.bam and write to stdout
 
  vt discover -b NA12878.bam -s NA12878 -r hs37d5.fa -i 20 -v snps,indels,mnps
 
<div class="mw-collapsible-content">
 
  usage : vt discover [options]
 
 
  options : -b  input BAM file
 
            -v  variant types [snps,mnps,indels]
 
            -f  fractional evidence cutoff for candidate allele [0.1]
 
            -e  evidence count cutoff for candidate allele [2]
 
            -q  base quality cutoff for bases [13]
 
            -m  MAPQ cutoff for alignments [20]
 
            -s  sample ID
 
            -r  reference sequence fasta file []
 
            -o  output VCF file [-]
 
            -I  file containing list of intervals []
 
            -i  intervals []
 
            --  ignores the rest of the labeled arguments following this flag
 
            -h  displays help
 
 
</div>
 
</div>
 
 
=== Discover2 ===
 
  
 
Discovers variants from reads in a BAM/CRAM file.
 
Discovers variants from reads in a BAM/CRAM file.
Line 1,113: Line 1,406:
 
<div class=" mw-collapsible mw-collapsed">
 
<div class=" mw-collapsible mw-collapsed">
 
   #discover variants from NA12878.bam and write to stdout
 
   #discover variants from NA12878.bam and write to stdout
   vt discover2 -b NA12878.bam -s NA12878 -r hs37d5.fa -i 20 -v snps,indels,mnps
+
   vt discover -b NA12878.bam -s NA12878 -r hs37d5.fa -i 20  
 
<div class="mw-collapsible-content">
 
<div class="mw-collapsible-content">
 
   usage : vt discover2 [options]  
 
   usage : vt discover2 [options]  
Line 1,168: Line 1,461:
 
             --  ignores the rest of the labeled arguments following this flag
 
             --  ignores the rest of the labeled arguments following this flag
 
             -h  displays help
 
             -h  displays help
 +
</div>
 +
</div>
 +
 +
=== Filter overlap ===
 +
 +
Removes overlapping variants in a VCF file by tagging such variants with the FILTER flag overlap.
 +
 +
<div class="mw-collapsible mw-collapsed">
 +
  #annotates variants that are overlapping 
 +
  vt filter_overlap in.vcf -r hs37d5.fa -o overlapped.tagged..vcf
 +
 +
<div class="mw-collapsible-content">
 +
  usage : vt filter_overlap [options] <in.vcf>
 +
 +
  options : -o  output VCF file [-]
 +
            -w  window overlap for variants [0]
 +
            -I  file containing list of intervals []
 +
            -i  intervals []
 +
            -?  displays help
 +
</div>
 +
</div>
 +
 +
<div class="mw-collapsible mw-collapsed">
 +
  #Use Remove overlap instead for versions older than Jan 12, 2017
 +
  vt remove_overlap in.vcf -r hs37d5.fa -o overlapped.tagged..vcf
 +
 +
<div class="mw-collapsible-content">
 +
    usage: vt remove_overlap [options] <in.vcf>
 +
    The old version has the same options except that it lacks the -w option
 +
    The change occurred in the following commit:
 +
    https://github.com/atks/vt/commit/ab5cf7e91b3baa5349f439e6fe92491ae19da1a6
 +
</div>
 +
</div>
 +
 +
=== Annotate Indels ===
 +
 +
Annotates indels with VNTR information and adds a VNTR record.  Facilitates the simultaneous calling of VNTR together with Indels and SNPs.
 +
 +
<div class=" mw-collapsible mw-collapsed">
 +
  #annotates indels from VCFs with VNTR information.
 +
  vt annotate_indels in.vcf -r hs37d5.fa -o annotated.sites.vcf
 +
 +
<div style="height:20em; overflow:auto; border: 2px solid #FFF">
 +
  CHROM  POS    ID      REF    ALT    QUAL    FILTER  INFO
 +
  20      82079  .      G      A      1255.98 .      NSAMPLES=1;E=43;N=51;ESUM=43;NSUM=51;FLANKSEQ=GGAGCACGCC[G/A]CCATGCCCGG
 +
  20      82217  .      G      A      1632.77 .      NSAMPLES=1;E=56;N=61;ESUM=56;NSUM=61;FLANKSEQ=GAGCCACCGC[G/A]CCCGGCCCAG
 +
  20      83250  .      CTGTGTGTG      C      .      .      NSAMPLES=1;E=18;N=35;ESUM=18;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:<VNTR>:GT
 +
  20      83250  .      CTGTGTGTGTG    C      .      .      NSAMPLES=1;E=3;N=35;ESUM=3;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:<VNTR>:GT
 +
  20      83251  .      TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG    <VNTR>  .      .      MOTIF=GT;RU=TG;FZ_CONCORDANCE=1;FZ_RL=52;FZ_LL=0;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FZ_RU_COUNTS=26,26;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG]TTTAGTATTT
 +
  20      83252  .      G      C      359.204 .      NSAMPLES=1;E=13;N=14;ESUM=13;NSUM=14;FLANKSEQ=CTCTCTCTCT[G/C]TGTGTGTGTG
 +
  20      83260  .      G      C      500.163 .      NSAMPLES=1;E=18;N=34;ESUM=18;NSUM=34;FLANKSEQ=CTGTGTGTGT[G/C]TGTGTGTGTG
 +
  20      83267  .      T      C      247.043 .      NSAMPLES=1;E=11;N=43;ESUM=11;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT
 +
  20      83275  .      T      C      609.669 .      NSAMPLES=1;E=24;N=43;ESUM=24;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT
 +
  20      90008  .      C      A      1546.88 .      NSAMPLES=1;E=52;N=60;ESUM=52;NSUM=60;FLANKSEQ=AACAGAAAAC[C/A]AAATACTGTA
 +
  20      91088  .      C      T      1766.04 .      NSAMPLES=1;E=58;N=66;ESUM=58;NSUM=66;FLANKSEQ=CCCAGCATAC[C/T]ATGGTTGTGC
 +
  20      91508  .      G      A      1266.93 .      NSAMPLES=1;E=44;N=53;ESUM=44;NSUM=53;FLANKSEQ=AATTAGTAAG[G/A]CTTACGTAAG
 +
  20      91707  .      C      T      888.134 .      NSAMPLES=1;E=30;N=53;ESUM=30;NSUM=53;FLANKSEQ=TGATTTTCTA[C/T]AGCAGGACCT
 +
  20      92527  .      A      G      828.593 .      NSAMPLES=1;E=34;N=40;ESUM=34;NSUM=40;FLANKSEQ=ATTAATTGCC[A/G]TTCTCTCTTT
 +
  20      93440  .      A      G      688.144 .      NSAMPLES=1;E=24;N=58;ESUM=24;NSUM=58;FLANKSEQ=TTGGATGCAT[A/G]GTCTGTAAAT
 +
  20      93636  .      TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT    <VNTR>  .      .      MOTIF=T;RU=T;FZ_CONCORDANCE=0.939394;FZ_RL=35;FZ_LL=0;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FZ_RU_COUNTS=31,33;FLANKSEQ=TCTAGGATTC[TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT
 +
  20      93646  .      C      CT      .      .      NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FLANKSEQ=TTTTTCTTTC[TTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT;GMOTIF=T;TR=20:93636:TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT:<VNTR>:T
 +
  20      93717  .      A      T      31.7622 .      NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKSEQ=CAGTGGCGTG[A/T]TCTTAGATCA
 +
  20      93931  .      G      A      628.149 .      NSAMPLES=1;E=22;N=53;ESUM=22;NSUM=53;FLANKSEQ=GATTACAGGT[G/A]TGAGCCGCTG
 +
  20      100699  .      C      T      809.09  .      NSAMPLES=1;E=28;N=61;ESUM=28;NSUM=61;FLANKSEQ=GGTGAAAAAT[C/T]ACCTGTCAGT
 +
  20      101362  .      G      A      1087.13 .      NSAMPLES=1;E=36;N=67;ESUM=36;NSUM=67;FLANKSEQ=TAATACTGAA[G/A]TTTACTTCTC
 +
 +
</div>
 +
 +
  The following shows the trace of how the algorithm works
 +
 +
    ============================================
 +
    ANNOTATING INDEL FUZZILY
 +
    ********************************************
 +
    EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT
 +
   
 +
    20:131948:C/CCA
 +
    EXACT REGION 131948-131965 (18)
 +
                CCACACACACACACACAA
 +
    FINAL EXACT REGION 131948-131965 (18)
 +
                      CCACACACACACACACAA
 +
    ********************************************
 +
    PICK CANDIDATE MOTIFS
 +
   
 +
    Longest Allele : C[CA]CACACACACACACACAA
 +
    detecting motifs for an str
 +
    seq: CCACACACACACACACACAA
 +
    len : 20
 +
    cmax_len : 10
 +
    candidate motifs: 25
 +
    AC : 0.894737 2 0
 +
    AAC : 0.5 3 0.0555556
 +
    ACC : 0.5 3 0.0555556
 +
    AAAC : 0.0588235 4 0.125 (< 2 copies)
 +
    ACCC : 0.0588235 4 0.125 (< 2 copies)
 +
    AACAC : 0.5 5 0.02
 +
    ACACC : 0.5 5 0.02
 +
    AAACAC : 0.0666667 6 0.0555556 (< 2 copies)
 +
    ACACCC : 0.0666667 6 0.0555556 (< 2 copies)
 +
    AACACAC : 0.5 7 0.0102041
 +
    ACACACC : 0.5 7 0.0102041
 +
    AAACACAC : 0.0769231 8 0.03125 (< 2 copies)
 +
    ACACACCC : 0.0769231 8 0.03125 (< 2 copies)
 +
    AACACACAC : 0.5 9 0.00617284 (< 2 copies)
 +
    ACACACACC : 0.5 9 0.00617284 (< 2 copies)
 +
    AAACACACAC : 0.0909091 10 0.02 (< 2 copies)
 +
    ACACACACCC : 0.0909091 10 0.02 (< 2 copies)
 +
    ********************************************
 +
    PICKING NEXT BEST MOTIF
 +
   
 +
    selected:        AC 0.89 0.00
 +
    ********************************************
 +
    DETECTING REPEAT TRACT FUZZILY
 +
    ++++++++++++++++++++++++++++++++++++++++++++
 +
    Exact left/right alignment
 +
   
 +
    repeat_tract              : CACACACACACACACA
 +
    position                  : [131949,131964]
 +
    motif_concordance        : 1
 +
    repeat units              : 8
 +
    exact repeat units        : 8
 +
    total no. of repeat units : 8
 +
   
 +
    ++++++++++++++++++++++++++++++++++++++++++++
 +
    Fuzzy right alignment
 +
   
 +
    repeat motif : CA
 +
    rflank      : AACTC
 +
    mlen        : 2
 +
    rflen        : 5
 +
    plen        : 111
 +
   
 +
    read        : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC
 +
    rlen        : 106
 +
   
 +
    optimal score: 50.5073
 +
    optimal state: MR
 +
    optimal track: MR|r|0|5
 +
    optimal probe len: 25
 +
    optimal path length : 107
 +
    max j: 106
 +
    probe: (1~82) [1~10] (1~5)
 +
    read : (1~82) [83~101] (102~106)
 +
   
 +
    motif #          : 10 [83,101]
 +
    motif concordance : 95% (9/10)
 +
    motif discordance : 0|1|0|0|0|0|0|0|0|0
 +
   
 +
    Model:  ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC
 +
          SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME
 +
                                                                                              oo++oo++oo++oo++oo++RRRRR
 +
    Read:  AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC
 +
   
 +
    ++++++++++++++++++++++++++++++++++++++++++++
 +
    Fuzzy left alignment
 +
   
 +
    lflank      : ATCTTA
 +
    repeat motif : CA
 +
    lflen        : 6
 +
    mlen        : 2
 +
    plen        : 111
 +
   
 +
    read        : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT
 +
    rlen        : 105
 +
   
 +
    optimal score: 50.5858
 +
    optimal state: Z
 +
    optimal track: Z|m|10|2
 +
    optimal probe len: 26
 +
    optimal path length : 106
 +
    max j: 105
 +
    mismatch penalty: 3
 +
   
 +
    model: (1~6) [1~10]
 +
    read : (1~6) [7~25][26~106]
 +
   
 +
    motif #          : 10 [7,25]
 +
    motif concordance : 95% (9/10)
 +
    motif discordance : 0|1|0|0|0|0|0|0|0|0
 +
   
 +
    Model:  ATCTTACACACACACACACACACACA--------------------------------------------------------------------------------
 +
          SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE
 +
            LLLLLLoo++oo++oo++oo++oo++                                                                               
 +
    Read:  ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT
 +
   
 +
    xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
 +
    VNTR Summary
 +
    rid          : 19
 +
    motif        : AC
 +
    ru          : CA
 +
   
 +
    Exact
 +
    repeat_tract                    : CACACACACACACACA
 +
    position                        : [131949,131964]
 +
    reference repeat unit length    : 8
 +
    motif_concordance              : 1
 +
    repeat units                    : 8
 +
    exact repeat units              : 8
 +
    total no. of repeat units      : 8
 +
   
 +
    Fuzzy
 +
    repeat_tract                    : CACCACACACACACACACA
 +
    position                        : [131946,131964]
 +
    reference repeat unit length    : 19
 +
    motif_concordance              : 0.95
 +
    repeat units                    : 19
 +
    exact repeat units              : 9
 +
    total no. of repeat units      : 10
 +
    xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
 +
 +
<div class="mw-collapsible-content">
 +
  usage : vt annotate_indels [options] <in.vcf>
 +
 +
  options : -v  add vntr record [false]
 +
            -x  override tags [false]
 +
            -f  filter expression []
 +
            -d  debug [false]
 +
            -m  mode [f]
 +
                e : by exact alignment              f : by fuzzy alignment
 +
            -c  classification schemas of tandem repeat [6]
 +
                1 : lai2003   
 +
                2 : kelkar2008 
 +
                3 : fondon2012 
 +
                4 : ananda2013 
 +
                5 : willems2014
 +
                6 : tan_kang2015
 +
            -a  annotation type [v]
 +
                v : a. output VNTR variant (defined by classification).
 +
                      RU                    repeat unit on reference sequence (CA)
 +
                      MOTIF                canonical representation (AC)
 +
                      RL                    repeat tract length in bases (11)
 +
                      FLANKS                flanking positions of repeat tract determined by exact alignment
 +
                      RU_COUNTS            number of exact repeat units and total number of repeat units in
 +
                                            repeat tract determined by exact alignment
 +
                      FZ_RL                fuzzy repeat tract length in bases (11)
 +
                      FZ_FLANKS            flanking positions of repeat tract determined by fuzzy alignment
 +
                      FZ_RU_COUNTS          number of exact repeat units and total number of repeat units in
 +
                                            repeat tract determined by fuzzy alignment
 +
                      FLANKSEQ              flanking sequence of indel
 +
                      LARGE_REPEAT_REGION  repeat region exceeding 2000bp
 +
                    b. mark indels with overlapping VNTR.
 +
                      FLANKS      flanking positions of repeat tract determined by exact alignment
 +
                      FZ_FLANKS    flanking positions of repeat tract determined by fuzzy alignment
 +
                      GMOTIF      generating motif used in fuzzy alignment
 +
                      TR    position and alleles of VNTR (20:23413:CACACACACAC:<VNTR>)
 +
                a : annotate each indel with RU, RL, MOTIF, REF.
 +
            -r  reference sequence fasta file []
 +
            -o  output VCF file [-]
 +
            -I  file containing list of intervals []
 +
            -i  intervals
 +
            -?  displays help
 
  </div>
 
  </div>
 
</div>
 
</div>
Line 1,211: Line 1,754:
 
  </div>
 
  </div>
 
</div>
 
</div>
 +
 +
= Pedigree File =
 +
 +
  vt understands an augmented version introduced by [mailto:hmkang@umich.edu Hyun] of the PED described by [http://zzz.bwh.harvard.edu/plink/data.shtml#ped plink].
 +
  The pedigree file format is as follows with the following mandatory fields:
 +
       
 +
{| class="wikitable"
 +
|-
 +
! scope="col"| Field
 +
! scope="col"| Description
 +
! scope="col"| Valid Values
 +
! scope="col"| Missing Values
 +
|-
 +
|Family ID<br>
 +
Individual ID<br>
 +
Paternal ID<br>
 +
Maternal ID<br>
 +
Sex<br>
 +
Phenotype
 +
|ID of this family <br>
 +
ID(s) of this individual (comma separated) <br>
 +
ID of the father <br>
 +
ID of the mother <br>
 +
Sex of the individual<br>
 +
Phenotype
 +
|[A-Za-z0-9_]+<br>
 +
[A-Za-z0-9_]+(,[A-Za-z0-9_]+)* <br>
 +
[A-Za-z0-9_]+ <br>
 +
[A-Za-z0-9_]+<br>
 +
1=male, 2=female, other, male, female<br>
 +
[A-Za-z0-9_]+
 +
|  0 <br>
 +
cannot be missing <br>
 +
0 <br>
 +
0 <br>
 +
other<br>
 +
-9
 +
|}
 +
 +
  Examples:   
 +
 +
    ceu      NA12878    NA12891    NA12892    female    -9
 +
    yri      NA19240    NA19239    NA19238    female    -9
 +
 +
    ceu      NA12878    NA12891    NA12892    2    -9
 +
    yri      NA19240    NA19239    NA19238    2    -9
 +
 +
    #allows tools like profile_mendelian to detect duplicates and check for concordance
 +
    ceu      NA12878,NA12878A    NA12891    NA12892    female  case
 +
    yri      NA19240            NA19239    NA19238    female  control
 +
 +
    #allows tools like profile_mendelian to detect duplicates and check for concordance
 +
    ceu      NA12412    0  0    female  case
 +
    yri      NA19650    0  0    female  control
  
 
= Resource Bundle =
 
= Resource Bundle =
  
* External : [ftp://share.sph.umich.edu/vt resource bundle]
+
== GRCh37 ==
 +
 
 +
Files are based on hs37d5.fa made by Heng Li.
 +
 
 +
* External : [ftp://share.sph.umich.edu/vt/grch37 GRCh37 resource bundle]
 
* Internal : /net/fantasia/home/atks/ref/vt/grch37
 
* Internal : /net/fantasia/home/atks/ref/vt/grch37
 +
 +
Read here for [ftp://share.sph.umich.edu/vt/grch37/readme.txt contents].
 +
 +
== GRCh38 ==
 +
 +
Files are based on [https://github.com/lh3/bwa/blob/master/README-alt.md hs38DH.fa] made by Heng Li.
 +
Note that many of the references are simply lifted over from GRCh37 using Picard's liftover tool with the default options.
 +
 +
* External : [ftp://share.sph.umich.edu/vt/grch38 GRCh38 resource bundle]
 +
* Internal : /net/fantasia/home/atks/ref/vt/grch38
 +
 +
Read here for [ftp://share.sph.umich.edu/vt/grch38/readme.txt contents].
  
 
= FAQ =
 
= FAQ =
Line 1,224: Line 1,837:
 
   For example, HG19 vs Grch37.  The key difference is that chromosome 1 is represented as chr1 and 1 respectively in the  
 
   For example, HG19 vs Grch37.  The key difference is that chromosome 1 is represented as chr1 and 1 respectively in the  
 
   FASTA files from these 2 sources.  Just use the appropriate FASTA file that was used to generate your VCF file originally.
 
   FASTA files from these 2 sources.  Just use the appropriate FASTA file that was used to generate your VCF file originally.
 +
 +
  Another common issue is due to the corruption of the index file of the reference sequence; say for a reference file named
 +
  hs37d5.fa or hs37d5.fa.gz, simply delete the index file denoted by hs37d5.fa.fai or hs37d5.fa.gz.fai and run the vt command
 +
  again.  A new index file will be generated automatically.
 +
 +
= How to cite vt? =
 +
 +
If you use normalize: <br>
 +
[http://bioinformatics.oxfordjournals.org/content/31/13/2202 Adrian Tan, Gonçalo R. Abecasis and Hyun Min Kang. Unified Representation of Genetic Variants. Bioinformatics (2015) 31(13): 2202-2204]
  
 
= Maintained by =
 
= Maintained by =
  
 
This page is maintained by  [mailto:atks@umich.edu Adrian]
 
This page is maintained by  [mailto:atks@umich.edu Adrian]

Latest revision as of 03:36, 4 May 2021

Introduction

vt is a variant tool set that discovers short variants from Next Generation Sequencing data.

Installation

General

The source files are housed in github. htslib is used and a copy of a developmental freeze is stored as part of the vt repository to ensure compatibility.

To install, perform the following steps:

 #this will create a directory named vt in the directory you cloned the repository
 1. git clone https://github.com/atks/vt.git  
#change directory to vt 2. cd vt
#update submodules 3. git submodule update --init --recursive
#run make, note that compilers need to support the c++0x standard 4. make
#you can test the build 5. make test
  An expected output when all is well for the tests is shown here. (click expand =>)
 user@server:~/vt$ make test
 test/test.sh
 ++++++++++++++++++++++
 Tests for vt normalize
 ++++++++++++++++++++++
 testing normalize
              output VCF file : ok
              output logs     : ok
 +++++++++++++++++++++++++++++++
 Tests for vt decompose_blocksub
 +++++++++++++++++++++++++++++++
 testing decompose_blocksub of even-length blocks
              output VCF file : ok
              output logs     : ok
 testing decompose_blocksub with alignment
              output VCF file : ok
              output logs     : ok
 testing decompose_blocksub of phased even-length blocks
              output VCF file : ok
              output logs     : ok
 ++++++++++++++++++++++
 Tests for vt decompose
 ++++++++++++++++++++++
 testing decompose for a triallelic variant
              output VCF file : ok
              output logs     : ok 
Passed tests : 5 / 5

Mac

You may install vt via homebrew.

  brew tap brewsci/bio
  brew tap brewsci/science
  
  brew install brewsci/bio/vt


Building has been tested on Linux and Mac systems on gcc 4.8.1 and clang 3.4.
Some features of C++11 are used, thus there is a need for newer versions of gcc and clang.

Updating

vt is currently under heavy development, you will probably need to update often.

 #remove all object files
 #you need to do this as source files as the static libraries might have changed and need to be removed.
 1. make clean 
#update source files 2. git pull
#compile and link, the -j option tells Makefile to run up to 40 independent commands in parallel 3. make -j 40

General Features and notes

Common options

   -i   multiple intervals in <seq>:<start>-<end> format delimited by commas.
   -I   multiple intervals in <seq>:<start>-<end> format listed in a text file line by line.
   -o   defines the out file which and has the STDOUT set as the default.
        vt recognizes the appropriate output by file extension.
        <name>.vcf     - uncompressed VCF
        <name>.vcf.gz  - compressed VCF
        <name>.bcf     - BCF
        You may modify the STDOUT to output the binary version of the format.  Uncompressed
        VCF and BCF streams are indicated by - and + respectively.  
   -f  filter expression
   -s  sequential region selection as opposed to random access of regions specified by the i option.
       This is useful when you want to select many close-by regions, while the -i option works,
       it is less efficient and also selects a variant multiple times if it overlaps 2 regions.  This 
       option iterates through the variants in the file sequentially and checks for overlap with the 
       bed file given.

Uncompressed BCF streams

htslib is designed with BCF as the underlying data structure and it has incorporated awareness of uncompressed BCF streams in the i/o API. One may use this feature to stream uncompressed BCF records to save on computational time spent on (de)compression.

 #using textual VCF streams indicated by -
 cat mills.vcf | vt normalize - -r hs37d5.fa | vt uniq - -o out.bcf
 #using uncompressed BCF streams indicated by +
 cat mills.vcf | vt normalize - -r hs37d5.fa -o + | vt uniq + -o out.bcf

In this example, the former took 0.84s while the latter took 0.64s to process. (24% speed up!)

Filters

For some programs. you may define a filter via the -f option.

 This allows you to only analyse biallelic indels that are passed on chromosome 20.
 vt profile_na12878 vt.bcf -g na12878.reference.txt -r genome.fa -f "N_ALLELE==2&&VTYPE==INDEL&&PASS"  -i 20
 This allows you to extract biallelic indels that are passed on chromosome 20.
 vt view vt.bcf -f "N_ALLELE==2&&VTYPE==INDEL&&PASS"  -i 20

Other examples of filters

 #all variants with a SNP in them
 VTYPE&SNP
 #Simple insertions of length 1
 VTYPE==INDEL&&DLEN==1
 #Indels of length 1
 VTYPE==INDEL&&LEN==1
 Variant characteristics
   VTYPE,N_ALLELE,DLEN,LEN,VARIANT_CONTAINS_N
 Variant value types
   SNP,MNP,INDEL,CLUMPED
 Biallelic SNPs only                         : VTYPE==SNP&&N_ALLELE==2
 Biallelic Indels with embedded SNP          : VTYPE==(SNP|INDEL)&&N_ALLELE==2
 Biallelic variants involving insertions     : VTYPE&INDEL&&DLEN>0&&N_ALLELE==2
 Biallelic variants involving 1bp variants   : LEN==1&&N_ALLELE==2
 Variants with explicit sequences with no Ns : ~VARIANT_CONTAINS_N 
 REF field
   REF
 ALT field
   ALT
 QUAL field
   QUAL
 FILTER fields
   PASS, FILTER.<tag>
 INFO fields
   INFO.<tag>
 
 A/C SNPs                                    : REF=='A' && ALT=='C'
 AC type of STRs                             : REF=~'^.(AC)+$' || ALT=~'^.(AC)+$'
 Passed biallelic SNPs only                  : PASS&&VTYPE==SNP&&N_ALLELE==2
 Passed Common biallelic SNPs only           : PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005
 Passed Common biallelic SNPs or rare indels : (PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005)||(VTYPE&INDEL&&INFO.AF<=0.005)
 Passed Common biallelic SNPs or rare indels : ((PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005)||(VTYPE&INDEL&&INFO.AF<=0.005))&&QUAL>100
 with quality greater than 100
 Failed rare variants : ~PASS&&(INFO.AC/INFO.AN<0.005)
 Regular expression matching PERL style (implemented with pcre2)  
 Sometimes, an info field will contain several values in a string with functional annotation, to match what you want,
 just use INFO.ANNO=~'<perl regular expression>'
 Passed variants in intergenic regions or UTR                    : PASS&&INFO.ANNO=~'Intergenic|UTR'
 Passed variants in intergenic regions or UTR ignoring case      : PASS&&INFO.ANNO=~'(?i)Intergenic|UTR' 
pcre2's '(?i)Intergenic|UTR' is equivalent to PERL's '/intergenic|UTR/i'
 Operations
 == : equivalence for strings and numbers
 != : not equal
 =~ : regular expression match for strings only
 ~~ : not of =~.  Is equivalent to PERL's !~, this notation is used as BASH keeps interpreting ! for recalling commands from the history
 ~  : logical not
 && : logical and
 || : logical or
 &  : bitwise and
 |  : bitwise or
 +  : add
 -  : subtract
 *  : multiply
 /  : divide
 

The following programs support filter expressions.

  • view
  • peek
  • profile_snps
  • profile_indels
  • profile_na12878
  • profile_mendelian
  • profile_len
  • profile_chrom
  • profile_afs
  • profile_hwe
  • concordance
  • partition

Alternate headers

 As BCF is a restrictive format of VCF where all meta data must be present in the header, 
 vt provides a mechanism to read an alternative header for VCF files that do not have a 
 well formed header.  Simply provide a header file stub named as <vcf-file>.hdr and vt
 will automatically read it instead of the original header in <vcf-file>.
 For more information about VCF/BCF : http://samtools.github.io/hts-specs/VCFv4.2.pdf
 This mechanism is available only if one is reading VCF or compressed VCF files.  It is
 disabled for BCF files as this might corrupt the BCF file because the encoding of the 
 fields in BCF records is based on the order of the meta info lines in the header.
 Note: BCF2.2 introduces the IDX field in meta information lines that indicates the 
 dictionary encoding. This feature might be enabled for BCF files in the future.

General cases of Ploidy and Alleles

 I am trying to make vt handle general cases of ploidy and alleles.  
 Please let me know if that is lacking in a tool that you are using.

BCF Compression Levels vs Compression Time

The zlib deflation algorithm (a variant of LZ77) has 10 levels - 0 to 9. 0 has no compression but instead wraps
up the file in zlib or bgzf blocks. It may be useful to have 0 compression as it is indexable with the same mechanism
used for compressed files. Levels 1-9 denote an increasing compression level in exchange for longer times for
compression.

In general, zlib compression does not have significant differences in compression for BCF files between the 9 compression
levels as shown in the following table:

Compression Level Size Time
0

1
2
3
4
5
6 (default)
7
8
9

153GB

98.4GB
98.0GB
97.5GB
95.5GB
95.2GB
94.9GB
94.8GB
94.76GB
94.75GB

45m

2h3m
2h7m
2h12m
2h26m
2h54m
3h19m
3h41m
4h5m
4h25m

So, it might be a good idea to compress at lower levels when dealing with large temporary
files in a pipeline to save compute time. This can be achieved with the -c option in vt view

VCF Manipulation

View

Views a VCF or VCF.GZ or BCF file.

  #views mills.bcf and outputs to standard out
  vt view -h mills.bcf 
  #views mills.bcf and locally sorts it in a 10000bp window and outputs to sorted-millsbcf
  vt view -h -w 10000 mills.bcf -o sorted-mills.bcf
  #views mills.bcf and outputs to c1-mills.bcf with a compression level of 1.  By default, 
  #the compression level is 6 where lower levels compress the file less but are faster. 
  #The difference in compression for BCF files between level 1 to level 9 is about 5% of 
  #of a level 1 compression file.  The difference in time taken is about an additional 50%
  #of a level 1 compression.  The levels range from 0 to 9 where 0 means no compression 
  #but the file is encapsulated in bgzf blocks that allows the file to be indexed.  A special 
  #level -1 denotes an uncompressed BCF file that is not encapsulated in bgzf blocks and 
  #are thus not indexable but are highly suitable for streaming between vt commands.
  vt view -h mills.bcf -c 1 -o c1-mills.bcf
  #views mills.bcf and selects variants that overlap with the regions found in dust.bed from chromosome 20
  #the -t option selects variants by checking if each variant overlaps with the regions in the bed file, this is
  #as opposed to random accessing the variants via the index through the intervals defined in -i and -I options.
  #this is useful when selecting variants from the target regions from an exome sequencing experiment.
  vt view 10000 mills.bcf -t dust.bed -i 20
 usage : vt view [options] <in.vcf>
 options : -o  output VCF/VCF.GZ/BCF file [-]
           -f  filter expression []
           -w  local sorting window size [0]
           -s  print site information only without genotypes [false]
           -H  print header only, this option is honored only for STDOUT [false]
           -h  omit header, this option is honored only for STDOUT [false]
           -p  print options and summary []
           -r  right window size for overlap []
           -l  left window size for overlap []
           -c  compression level 0-9, 0 and -1 denotes uncompressed with the former being wrapped in bgzf. [6]
           -t  bed file for variant selection via streaming []
           -I  file containing list of intervals []
           -i  intervals []
           -?  displays help

Index

Indexes a VCF.GZ or BCF file.

  #indexes mills.bcf
  vt index mills.bcf 
  #indexes mills.vcf.gz
  vt index mills.vcf.gz 
 usage : vt index [options] <in.vcf>
 options : -p  print options and summary []
           --  ignores the rest of the labeled arguments following this flag
           -h  displays help

Sorting

Sorting may be done in 3 approaches.

Locally:
Performs sorting within a local window. The window size may be set by the -w option. The default window size
is 1000bp and if a record is detected to be potentially out of order due to a small window size, it wil be reported.
Use this when your VCF records are grouped by chromosome but not ordered in short stretches.

By chromosome:
Your VCF file is not ordered by the chromosomes in the header but is fully ordered within each chromosome.
The VCF file should be indexed and vt will output the records in the order of chromosomes given in the header.

Full sort [default option]:
No assumptions are made about the VCF file. Records will be ordered by the order of contigs in the header.
Smaller temporary ordered files are created and their names are <output_vcf>.<no>.bcf and after generating
these files, they are merged and output into <output_vcf>.

  #sorts mills.bcf and outputs to standard out in a 1000bp window.
  vt sort -m local mills.bcf 
  #sorts mills.bcf and locally sorts it in a 10000bp window and outputs to out.bcf
  vt sort -m local -w 10000 mills.bcf -o out.bcf 
  #sorts an indexed mills.bcf  with chromosomes not sorted in the contig order in the header 
  vt sort -m chrom  mills.bcf -o out.bcf 
  #sorts mills.bcf with no assumption
  vt sort mills.bcf -o out.bcf 
 usage : vt sort [options] <in.vcf>
 options : -m  sorting modes. [full]
               local : locally sort within a 1000bp window.  Window size may be set by -w.
               chrom : sort chromosomes based on order of contigs in header.
                       input must be indexed.
               full  : full sort with no assumptions.
           -o  output VCF/VCF.GZ/BCF file. [-]
           -w  local sorting window size, set by default to 1000 under local mode. [0]
           -p  print options and summary. []
           -?  displays help

Normalization

Normalize variants in a VCF file (Tan et al. 2015) . Normalized variants may have their positions changed; in such cases, the normalized variants are reordered and output in an ordered fashion. The local reordering takes place over a window of 10000 base pairs which may be changed via the -w option. There is an underlying assumption that the REF field is consistent with the reference sequence use, vt will check for this and will fail if reference inconsistency is encountered; this may be relaexd with the -n option.

  #normalize variants and write out to dbsnp.normalized.vcf
  vt normalize dbsnp.vcf -r seq.fa -o dbsnp.normalized.vcf
  #normalize variants, send to standard out and remove duplicates.
  vt normalize dbsnp.vcf -r seq.fa | vt uniq - -o dbsnp.normalized.uniq.vcf
  #read in variants that do not contain N in the explicit alleles, normalize variants, send to standard out.
  vt normalize dbsnp.vcf -r seq.fa -f "~VARIANT_CONTAINS_N"
  #variants that are normalized will be annotated with an OLD_VARIANT info tag.
  #CHROM  POS      ID   REF           ALT  QUAL  FILTER  INFO
  19	  29238772 .	C             G    .     PASS	 VT=SNP;OLD_VARIANT=19:29238771:TC/TG
  20	  60674709 .	GCCCAGCCCCAC  G    .     PASS	 VT=INDEL;OLD_VARIANT=20:60674718:CACCCCAGCCCC/C
  #this shows a sample output with the normalization operations that were used 
  #categorized into 5 categories each for biallelic and multiallelic variants. 
stats: biallelic no. left trimmed : 156908 no. right trimmed : 323 no. left and right trimmed : 33 no. right trimmed and left aligned : 7 no. left aligned : 12360
total no. biallelic normalized : 169631

multiallelic no. left trimmed : 627189 no. right trimmed : 2509 no. left and right trimmed : 1498 no. right trimmed and left aligned : 212 no. left aligned : 1783
total no. multiallelic normalized : 633191
total no. variants normalized : 802822 total no. variants observed : 88052639
  usage : vt normalize [options] <in.vcf>
 options : -o  output VCF file [-]
           -d  debug [false]
           -q  do not print options and summary [false]
           -m  warns but does not exit when REF is inconsistent
               with masked reference sequence for non SNPs.
               This overides the -n option [false]
           -n  warns but does not exit when REF is inconsistent
               with reference sequence for non SNPs [false]
           -w  window size for local sorting of variants [10000]
           -I  file containing list of intervals []
           -i  intervals []
           -r  reference sequence fasta file []
           -?  displays help

Decompose biallelic block substitutions

Decomposes biallelic block substitutions into its constituent SNPs.
There is now an additional option -a which decomposes non block substitutions into its constituent SNPs and indels. (kindly added by [holtgrewe@github])
There is no exact solution and this decomposition is based on the best guess outcome using a Needleman-Wunsch algorithm.
You might also want to check out vcfallelicprimitives.

There is now an additional option -m and -d which ensures that some MNVs are not decomposed. (kindly added by [jaudoux@github])
The motivation is from

  #decomposes biallelic block substitutions and write out to decomposed_blocksub.vcf
  vt decompose_blocksub gatk.vcf -o decomposed_blocksub.vcf 
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . CA TG 50340.1 PASS AC=1;AN=2 GT 0|1
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . C T 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CA/TG GT 0|1 20 763838 . A G 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CA/TG GT 0|1
  #decomposes biallelic clumped variant and write out to decomposed_blocksub.vcf
  vt decompose_blocksub -a gatk.vcf -o decomposed_blocksub.vcf 
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . CG TGA 50340.1 PASS AC=1;AN=2 GT 0|1
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . C T 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1 20 763838 . G GA 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1
  #decomposes biallelic clumped variant and write out to decomposed_blocksub.vcf and add phase set information in the genotype fields
  vt decompose_blocksub -p gatk.vcf -o decomposed_blocksub.vcf 
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT tumor normal 1 159030 . TAACCTTTC TGACCTTTT 0.04 . AF=0.5 GT 0/0 1/1
#after decomposition 1 159031 . A G 0.04 . AF=0.5;OLD_CLUMPED=1:159030:TAACCTTTC/TGACCTTTT GT:PS 0|0:159031 1|1:159031 1 159038 . C T 0.04 . AF=0.5;OLD_CLUMPED=1:159030:TAACCTTTC/TGACCTTTT GT:PS 0|0:159031 1|1:159031
  description : decomposes biallelic block substitutions into its constituent SNPs. 
usage : vt decompose_blocksub [options] <in.vcf>
options : -m keep MNVs (multi-nucleotide variants) [false] -a enable aggressive/alignment mode [false] -d MNVs max distance (when -m option is used) [2] -o output VCF file [-] -I file containing list of intervals [] -i intervals [] -? displays help-a enable aggressive/alignment mode

Decompose

Decompose multiallelic variants in a VCF file. If the VCF file has genotype fields GT,PL, GL or DP, they are modified to reflect the change in alleles. All other genotype fields are removed. The -s option will retain the fields and decompose fields of counts R and A accordingingly.

Decomposition and combining variants is a complex operation where the correctness is dependent on [tfarrah@github]:

  • whether the observed variants are seen in the same sample,
  • if same sample, whether they are homozygous or heterozygous,
  • if both heterozygous, whether they are in the same haplotype or not (if known).

and one should be aware of the issues in handling variants resulting from such operations.
The original purpose of this tool is to allow for allelic comparisons between call sets. [example of a problem caused in combining separate variant records]

  #decomposes multiallelic variants into biallelic variants and write out to gatk.decomposed.vcf
  vt decompose gatk.vcf -o gatk.decomposed.vcf 
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA,TAAA,T . PASS AF=0.342,0.173,0.037 GT:DP:PL 1/2:81:281,5,9,58,0,115,338,46,116,809 0/0:86:0,30,323,31,365,483,38,291,325,567
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA . PASS OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL 1/.:281,5,9 0/0:0,30,323 1 3759889 . TA TAAA . . OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./1:281,58,115 0/0:0,31,483 1 3759889 . TA T . . OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./.:281,338,809 0/0:0,38,567
One might want to post process the partial genotypes like 1/. to the best guess genotype based on the PL values.
  #decomposes multiallelic variants into biallelic variants and write out to gatk.decomposed.vcf with the -s option.
  #-s option splits up INFO and GENOTYPE fields that have number counts of R and A [VCFv4.2 section 1.2.2] appropriately.
  vt decompose -s gatk.vcf -o gatk.decomposed.vcf 
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA,TAAA,T . PASS AF=0.342,0.173,0.037 GT:DP:PL 1/2:81:281,5,9,58,0,115,338,46,116,809 0/0:86:0,30,323,31,365,483,38,291,325,567
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA . PASS AF=0.342;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL 1/.:281,5,9 0/0:0,30,323 1 3759889 . TA TAAA . . AF=0.173;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./1:281,58,115 0/0:0,31,483 1 3759889 . TA T . . AF=0.037;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./.:281,338,809 0/0:0,38,567
In general, you should recompute fields that involves alleles after decomposition. Information is generally lost after vertically decomposing a variant, so care should be taken in interpreting the resultant values.
  description : decomposes multiallelic variants into biallelic in a VCF file. 
usage : vt decompose [options] <in.vcf>
options : -s smart decomposition [false] -o output VCF file [-] -I file containing list of intervals [] -i intervals [] -? displays help

Drop duplicate variants

Drops duplicate variants that appear later in the file. VCF file must be ordered.
If there are OLD_VARIANT tags in the INFO field, the variants in these tags are aggregated in the unique record retained.

  #drop duplicate variants and save output in mills.uniq.vcf
  vt uniq mills.vcf -o mills.uniq.vcf
  usage : vt uniq [options] <in.vcf>
  options : -o  output VCF file [-]
            -I  file containing list of intervals []
            -i  intervals []
            -?  displays help

Paste

Pastes VCF files like the unix paste functions.

 Input requirements and assumptions:
     1. Same variants are represented in the same order for each file (required)
     2. Genotype field order are the same for corresponding records (required)
     3. Sample names are different in all the files (warning will be given if not)
     4. Headers are the same for all the files (assumption, not checked, will fail if output is BCF)
 Outputs:
     1. INFO fields output will be that of the first file
     2. Genotype fields are the same for corresponding records
  #paste together genotypes from the CEU trio into one file.
  vt paste NA12878.mills.bcf NA12891.mills.bcf NA12892.mills.bcf -o ceu_trio.bcf
 usage : vt paste [options] <in1.vcf>...
 
 options : -L  file containing list of input VCF files
           -o  output VCF file [-]
           -p  print options and summary []
           -?  displays help

Concatenate

Concatenates VCF files. Assumes individuals are in the same order and files share the same header.

  #concatenates chr1.mills.bcf and chr2.mills.bcf
  vt cat chr1.mills.bcf chr2.mills.bcf -o mills.bcf
  #concatenates chr1.mills.bcf and chr2.mills.bcf with the naive option.
  #The naive option assumes that the headers are all the same and skips 
  #merging headers and translating encodings between BCF files.   This is 
  #a much faster option if you know the nature of your BCF files in advance.
  vt cat -n chr1.mills.bcf chr2.mills.bcf -o mills.bcf
 usage : vt cat [options] <in1.vcf>...
 options : -s  print site information only without genotypes [false]
           -p  print options and summary [false]
           -n  naive, assumes that headers are the same. [false]
           -w  local sorting window size [0]
           -f  filter expression []
           -L  file containing list of input VCF files
           -o  output VCF file [-]
           -I  file containing list of intervals []
           -i  intervals
           -?  displays help

Remove info tags

Removes INFO tags from a VCF file

  #removes the INFO tags OLD_VARIANT, ENTROPY, PSCORE and COMP 
  vt rminfo exact.del.bcf -t OLD_VARIANT,ENTROPY,PSCORE,COMP -o rm.bcf
 usage : vt rminfo [options] <in.vcf>
 options : -o  output VCF file [-]
           -q  do not print options and summary [false]
           -t  list of info tags to be removed []
           -I  file containing list of intervals []
           -i  intervals []
           -?  displays help

Filter

Filters variants in a VCF file

  #adds a filter tag "refA" for variants where the REF column is a A sequence.
  vt filter in.bcf -f "REF=='A'" -d "refA" 
  usage : vt filter [options] <in.vcf> 
options : -x clear filter [false] -f filter expression [] -d filter tag description [] -t filter tag [] -o output VCF file [-] -I file containing list of intervals [] -i intervals
-? displays help

Filter overlap

Tags overlapping variants in a VCF file with the FILTER flag overlap.

  #adds a filter tag "overlap" for overlapping variants within a window size of 1 based on the REF sequence.
  vt filter_overlap in.bcf -w 1 out.bcf
  todo: option for considering END info tag for detecting overlaps.
  usage : vt filter_overlap [options] <in.vcf>
  
  options : -o  output VCF file [-]
            -w  window overlap for variants [0]
            -I  file containing list of intervals []
            -i  intervals []
            -?  displays help

Validate

Checks the following properties of a VCF file:

  1. order
  2. reference sequence consistency
  #validates lobstr.bcf
  vt validate lobstr.bcf
 usage : vt validate [options] <in.vcf>
 
 options : -q  do not print invalid records [false]
           -I  file containing list of intervals []
           -i  intervals []
           -r  reference sequence fasta file []
           -?  displays help

Extract INFO fields to a tab delimited file

Converts a VCF file and its shared information in the INFO field to a tab delimited file for further analysis.

  #converts in.bcf to tab format with selected INFO and FILTER fields
  vt info2tab in.bcf -u PASS -t EX_RL,FZ_RL,MDUST,LOBSTR,VNTRSEEK,RMSK,EX_REPEAT_TRACT
 INPUT
 =====
 20	17548608	.	A	AC	.	PASS	CENTERS=vbi;NCENTERS=1;OLD_MULTIALLELIC=20:17548598:GAAAAAAAAAAAAA/GAAAAAAAAAAAA/GAAAAAAAAAAAAAA/GAAAAAAAAAA/GAAAAAAAAAAA/GAAAAAAAAAACAAA;OLD_VARIANT=20:17548598:GAAAAAAAAAAAAAG/GAAAAAAAAAACAAAG;EX_MOTIF=C;EX_MLEN=1;EX_RU=C;EX_BASIS=C;EX_BLEN=1;EX_REPEAT_TRACT=17548608,17548609;EX_COMP=100,0,0,0;EX_ENTROPY=0;EX_ENTROPY2=0;EX_KL_DIVERGENCE=2;EX_KL_DIVERGENCE2=4;EX_REF=2;EX_RL=2;EX_LL=3;EX_RU_COUNTS=0,2;EX_SCORE=0;EX_TRF_SCORE=-14;FZ_MOTIF=A;FZ_MLEN=1;FZ_RU=A;FZ_BASIS=A;FZ_BLEN=1;FZ_REPEAT_TRACT=17548599,17548611;FZ_COMP=100,0,0,0;FZ_ENTROPY=0;FZ_ENTROPY2=0;FZ_KL_DIVERGENCE=2;FZ_KL_DIVERGENCE2=4;FZ_REF=13;FZ_RL=13;FZ_LL=14;FZ_RU_COUNTS=13,13;FZ_SCORE=1;FZ_TRF_SCORE=26;FLANKSEQ=GAAAAAAAAA[A]AAAGAAGGAA;MDUST;LOBSTR
 20	17548608	.	AAAAG	A	.	PASS	CENTERS=ox1;NCENTERS=1;EX_MOTIF=AAAG;EX_MLEN=4;EX_RU=AAAG;EX_BASIS=AG;EX_BLEN=2;EX_REPEAT_TRACT=17548609,17548612;EX_COMP=100,0,0,0;EX_ENTROPY=0;EX_ENTROPY2=0;EX_KL_DIVERGENCE=2;EX_KL_DIVERGENCE2=4;EX_REF=0.75;EX_RL=4;EX_LL=4;EX_RU_COUNTS=0,1;EX_SCORE=0.75;EX_TRF_SCORE=-1;FZ_MOTIF=A;FZ_MLEN=1;FZ_RU=A;FZ_BASIS=A;FZ_BLEN=1;FZ_REPEAT_TRACT=17548599,17548611;FZ_COMP=100,0,0,0;FZ_ENTROPY=0;FZ_ENTROPY2=0;FZ_KL_DIVERGENCE=2;FZ_KL_DIVERGENCE2=4;FZ_REF=13;FZ_RL=13;FZ_LL=13;FZ_RU_COUNTS=13,13;FZ_SCORE=1;FZ_TRF_SCORE=26;FLANKSEQ=GAAAAAAAAA[AAAAG]AAGGAACTAC;MDUST;LOBSTR;OLD_VARIANT=20:17548598:GAAAAAAAAAAAAAG/GAAAAAAAAAA
 OUTPUT
 ======
 CHROM	POS	   REF	  ALT	N_ALLELE  PASS  EX_RL  FZ_RL	MDUST	LOBSTR	VNTRSEEK  RMSK	EX_REPEAT_TRACT_1	EX_REPEAT_TRACT_2
 20	17548608   A	  AC	2         1     2      13	1	1	0	  0     17548608                17548608
 20	17548608   AAAAG  A	2         1     4      13       1       1       0         0     17548609                17548609
 usage : vt info2tab [options] <in.vcf>
 
 options : -d  debug [false]
           -f  filter expression []
           -u  list of filter tags to be extracted []-t  list of info tags to be extracted []
           -o  output tab delimited file [-]
           -I  file containing list of intervals []
           -i  intervals []
           -?  displays help

VCF Inspection and Evaluation

Peek

Summarizes the variants in a VCF file

  #summarizes the variants found in mills.vcf
  vt peek mills.vcf
 usage : vt peek [options] <in.vcf>
 options : -o  output VCF file [-]
           -I  file containing list of intervals []
           -i  intervals []
           -r  reference sequence fasta file []
           --  ignores the rest of the labeled arguments following this flag
           -h  displays help

For a more detailed guide on variant classification.

#This is a sample output of a peek command which summarizes the variants found in a VCF file.
  stats: no. of samples                     :          0
         no. of chromosomes                 :         22
========== Micro variants ==========
no. of SNPs : 77228885 2 alleles (ts/tv) : 77011302 (2.11) [52287790/24723512] 3 alleles (ts/tv) : 216560 (0.75) [185520/247600] 4 alleles (ts/tv) : 1023 (0.50) [1023/2046]
no. of MNPs : 0 2 alleles (ts/tv) : 0 (-nan) [0/0] >=3 alleles (ts/tv) : 0 (-nan) [0/0]
no. Indels : 2147564 2 alleles (ins/del) : 2124842 (0.47) [683250/1441592] >=3 alleles (ins/del) : 22722 (2.12) [32411/15286]
no. SNP/MNP : 0 3 alleles (ts/tv) : 0 (-nan) [0/0] >=4 alleles (ts/tv) : 0 (-nan) [0/0]
no. SNP/Indels : 12913 2 alleles (ts/tv) (ins/del) : 412 (0.41) [120/292] (3.68) [324/88] >=3 alleles (ts/tv) (ins/del) : 12501 (0.43) [7670/17649] (18.64) [12434/667]
no. MNP/Indels : 153 2 alleles (ts/tv) (ins/del) : 0 (-nan) [0/0] (-nan) [0/0] >=3 alleles (ts/tv) (ins/del) : 153 (0.30) [138/465] (0.27) [67/248]
no. SNP/MNP/Indels : 2 3 alleles (ts/tv) (ins/del) : 0 (-nan) [0/0] (-nan) [0/0] 4 alleles (ts/tv) (ins/del) : 2 (0.00) [3/5] (1.00) [3/3] >=5 alleles (ts/tv) (ins/del) : 0 (-nan) [0/0] (-nan) [0/0]
no. of clumped variants : 19025 2 alleles : 0 (-nan) [0/0] (-nan) [0/0] 3 alleles : 18508 (0.16) [12152/75366] (0.00) [93/18653] 4 alleles : 451 (0.15) [369/2390] (0.33) [201/609] >=5 alleles : 66 (0.09) [37/414] (1.19) [107/90]
====== Other useful categories =====
no. complex variants : 32093 2 alleles (ts/tv) (ins/del) : 412 (0.41) [120/292] (3.68) [324/88] >=3 alleles (ts/tv) (ins/del) : 31681 (0.21) [20369/96289] (0.64) [12905/20270]
======= Structural variants ========
no. of structural variants : 41217 2 alleles : 38079 deletion : 13135 insertion : 16451 mobile element : 16253 ALU : 12513 LINE1 : 2911 SVA : 829 numt : 198 duplication : 664 inversion : 100 copy number variation : 7729 >=3 alleles : 3138 copy number variation : 3138
========= General summary ==========
no. of reference : 0
no. of observed variants : 79449759 no. of unclassified variants : 0

Partition

Partition variants from two data sets.

 Please note that this only works if the contigs in the headers of both data sets are the same.
  #partitions all variants in bi1.bcf  and bi2.bcf
  vt partition bi1.bcf bi2.bcf
 Options:     input VCF file a   bi1.bcf
              input VCF file b   bi2.bcf 
A: 504676 variants B: 1389333 variants
ts/tv ins/del A-B 37564 [0.19] [1.34] A&B 467112 [1.55] [0.72] B-A 922221 [1.20] [0.58] of A 92.6% of B 33.6%
  #partitions only passed variants in bi1.bcf and bi2.bcf
  vt partition bi1.bcf bi2.bcf -f PASS
 Options:     input VCF file a   bi1.bcf
              input VCF file b   bi2.bcf 
              [f] filter             PASS 
A: 466148 variants B: 986056 variants
ts/tv ins/del A-B 47261 [0.44] [1.36] A&B 418887 [1.80] [0.68] B-A 567169 [1.43] [0.72] of A 89.9% of B 42.5%

partition v0.5

description : partition variants. check the overlap of variants between 2 data sets.

 usage : vt partition [options] <in1.vcf><in2.vcf>
 options : -w  write partitioned variants to file
           -f  filter
           -I  file containing list of intervals []
           -i  intervals []
           -?  displays help

Multi Partition

Partitions variants found in VCF files.
In comparison to the simple 2 way partition, this does not support writing out of partitions to file and reporting proportion of shared variants for each VCF.

  #partitions variants n-ways
  vt multi_partition hc.genotypes.bcf pl.genotypes.bcf st.genotypes.bcf
 Options:     input VCF file a   hc.genotypes.bcf
              input VCF file b   pl.genotypes.bcf
              input VCF file c   st.genotypes.bcf 
A: 97274 variants B: 95458 variants C: 98943 variants
no [ts/tv] [ins/del] A-- 3887 [1.10] [0.86] -B- 7890 [1.45] [0.98] AB- 4360 [0.99] [1.32] --C 8277 [1.75] [2.21] A-C 7458 [1.78] [0.49] -BC 1639 [1.63] [1.03] ABC 81569 [2.28] [1.08]
Unique variants : 115080 Overall concordance : 70.88% (#intersection/#union)
 usage : vt multi_partition [options] <in1.vcf><in2.vcf>...
 options : -f  filter
           -I  file containing list of intervals []
           -i  intervals []
           -?  displays help

Annotate Regions

Annotates regions in a VCF file. The BED file should be bgzipped and indexed with tabix.

  #annotates the variants that overlap with coding regions.
  vt annotate_regions mills.vcf -b coding.bed.gz -t CDS -d "Coding region"
  #annotates the variants that overlap with low complexity regions.
  vt annotate_regions mills.vcf -b mdust.bed.gz -t DUST -d "DUST Low Complexity Region"
 usage : vt annotate_regions [options] <in.vcf>
 options : -d  regions tag description []
           -t  regions tag []
           -b  regions BED file []
           -o  output VCF file [-]
           -I  file containing list of intervals []
           -i  intervals
           -?  displays help

Annotate Variants

Annotates variants in a VCF file. The GENCODE annotation file should be bgzipped and indexed with tabix. This is available in the vt resource bundle.

  #annotates the variants found in mills.vcf
  vt annotate_variants mills.vcf -r hs37d5.fa -g gencode.v19.annotation.gtf.gz
 #annotates variants with the following fields
 ##INFO=<ID=VT,Number=1,Type=String,Description="Variant Type - SNP, MNP, INDEL, CLUMPED"> 
 ##INFO=<ID=GENCODE_FS,Number=0,Type=Flag,Description="Frameshift INDEL">
 ##INFO=<ID=GENCODE_NFS,Number=0,Type=Flag,Description="Non Frameshift INDEL">
 usage : vt annotate_variants [options] <in.vcf>
 options : -g  GENCODE annotations GTF file []
           -r  reference sequence fasta file []
           -o  output VCF file [-]
           -I  file containing list of intervals []
           -i  intervals
           -?  displays help

Compute Features

Compute features in a VCF file. Example of statistics are Allele counts, Genotype Likelihood based Inbreeding Coefficient. Hardy-Weinberg Genotype Likelihood based Allele Frequencies
For more customizable feature computation - look at estimate

  #compute features for the variants found in vt.vcf
  #requires GT, PL and DP
  vt compute_features vt.vcf
 #annotates variants with the following fields
 ##INFO=<ID=AC,Number=A,Type=Integer,Description="Alternate Allele Counts">
 ##INFO=<ID=AN,Number=1,Type=Integer,Description="Total Number Allele Counts">
 ##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
 ##INFO=<ID=AF,Number=A,Type=Float,Description="Alternate Allele Frequency">
 ##INFO=<ID=GC,Number=G,Type=Integer,Description="Genotype Counts">
 ##INFO=<ID=GN,Number=1,Type=Integer,Description="Total Number of Genotypes Counts">
 ##INFO=<ID=GF,Number=G,Type=Float,Description="Genotype Frequency">
 ##INFO=<ID=HWEAF,Number=A,Type=Float,Description="Genotype likelihood based MLE Allele Frequency assuming HWE">
 ##INFO=<ID=HWEGF,Number=G,Type=Float,Description="Genotype likelihood based MLE Genotype Frequency assuming HWE">
 ##INFO=<ID=MLEAF,Number=A,Type=Float,Description="Genotype likelihood based MLE Allele Frequency">
 ##INFO=<ID=MLEGF,Number=G,Type=Float,Description="Genotype likelihood based MLE Genotype Frequency">
 ##INFO=<ID=HWE_LLR,Number=1,Type=Float,Description="Genotype likelihood based Hardy Weinberg ln(Likelihood Ratio)">
 ##INFO=<ID=HWE_LPVAL,Number=1,Type=Float,Description="Genotype likelihood based Hardy Weinberg Likelihood Ratio Test Statistic ln(p-value)">
 ##INFO=<ID=HWE_DF,Number=1,Type=Integer,Description="Degrees of freedom for Genotype likelihood based Hardy Weinberg Likelihood Ratio Test Statistic">
 ##INFO=<ID=FIC,Number=1,Type=Float,Description="Genotype likelihood based Inbreeding Coefficient">
 ##INFO=<ID=AB,Number=1,Type=Float,Description="Genotype likelihood based Allele Balance">
 usage : vt compute_features for variants [options] <in.vcf>

 options : -s  print site information only without genotypes [false]
           -o  output VCF/VCF.GZ/BCF file [-]
           -f  filter expression []
           -I  File containing list of intervals
           -i  Intervals
           -?  displays help

Estimate

 Compute variant based estimates.  
 Example of statistics are:
 * Allele counts
 * Hardy-Weinberg Genotype Likelihood based Allele Frequencies
 * Genotype Likelihood based Inbreeding Coefficient
 * Genotype Likelihood based Hardy-Weinberg test
 * Genotype Likelihood based Allele Balance
  #compute features for the variants found in vt.vcf
  #requires GT and PL
  vt estimate -e AF,MLEAF vt.vcf
  AF         Genotype (GT) based allele frequencies
             If genotypes are unavailable, best guess
             genotypes are inferred based on genotype
             likelihoods (GL or PL)
             AC        : Alternate Allele counts
             AN        : Total allele counts
             NS        : No. of samples.
             AF        : Alternate allele frequencies.
  MLEAF      GL based allele frequencies estimates
             MLEAF     : Alternate allele frequency derived from MLEGF
             MLEGF     : Genotype frequencies.
  HWEAF      GL based allele frequencies estimates assuming HWE
             HWEAF     : Alternate allele frequencies
             HWEGF     : Genotype frequencies derived from HWEAF.
  HWE        GL based Hardy-Weinberg statistics.
             HWE_LLR   : log likelihood ratio
             HWE_LPVAL : log p-value
             HWE_DF    : degrees of freedom
  AB         GL based Allele Balance.
  FIC        GL based Inbreeding Coefficient
 usage : vt estimate [options] <in.vcf>

 options : -s  print site information only without genotypes [false]
           -o  output VCF/VCF.GZ/BCF file [-]
           -e  comma separated estimates to be computed []
           -f  filter expression []
           -I  File containing list of intervals
           -i  Intervals
           -?  displays help

Profile Mendelian Errors

Profile Mendelian errors

  #profile mendelian errors found in vt.genotypes.bcf, generate tables in the directory mendel, requires pdflatex.
  vt profile_mendelian vt.genotypes.bcf -p trios.ped -x mendel
  pedigree file format is described in here.
  #this is a sample output for mendelian error profiling.
  #R and A stand for reference and alternate allele respectively.
  #Error% - mendelian error (confounded with de novo mutation)
  #HomHet - Homozygous-Heterozygous genotype ratios
  #Het% - proportion of hets
  Mendelian Errors 
Father Mother R/R R/A A/A Error(%) HomHet Het(%) R/R R/R 14889 210 38 1.64 nan nan R/R R/A 3403 3497 74 1.06 0.97 50.68 R/R A/A 176 1482 155 18.26 nan nan R/A R/R 3665 3652 68 0.92 1.00 49.91 R/A R/A 1015 3151 990 0.00 0.64 61.11 R/A A/A 43 1300 1401 1.57 1.08 48.13 A/A R/R 172 1365 147 18.94 nan nan A/A R/A 47 1164 1183 1.96 1.02 49.60 A/A A/A 20 78 5637 1.71 nan nan
Parental R/R R/A A/A Error(%) HomHet Het(%) R/R R/R 14889 210 38 1.64 nan nan R/R R/A 7068 7149 142 0.99 0.99 50.28 R/R A/A 348 2847 302 18.59 nan nan R/A R/A 1015 3151 990 0.00 0.64 61.11 R/A A/A 90 2464 2584 1.75 1.05 48.81 A/A A/A 20 78 5637 1.71 nan nan
Parental R/R R/A A/A Error(%) HomHet Het(%) HOM HOM 14909 288 5675 1.66 nan nan HOM HET 7158 9613 2726 1.19 1.00 49.90 HET HET 1015 3151 990 0.00 0.64 61.11 HOMREF HOMALT 348 2847 302 18.59 nan nan
total mendelian error : 2.505% no. of trios : 2 no. of variants : 25346

profile_mendelian v0.5

 usage : vt profile_mendelian [options] <in.vcf>
 options : -q  minimum genotype quality
           -d  minimum depth
           -r  reference sequence fasta file []
           -x  output latex directory []
           -p  pedigree file
           -I  file containing list of intervals []
           -i  intervals
          -?  displays help

Profile SNPs

Profile SNPs. The reference data sets can be obtained from vt resource bundle.

  #profile snps found in 20.sites.vcf
  vt profile_snps -g snp.reference.txt 20.sites.vcf -r hs37d5.fa  -i 20
 #this is a sample output for indel profiling.
 # square brackets contain the ts/tv ratio.  
 # The numbers in curved bracket are the counts of ts and tv SNPs respectively.
 # Low complexity shows what percent of the SNPs are in low complexity regions.
  data set
    No. SNPs          :     508603 [2.09]
       Low complexity :       0.08 (39837/508603) 
1000g A-B 109970 [1.39] A&B 398633 [2.37] B-A 1340682 [2.26] Precision 78.4% Sensitivity 22.9%
dbsnp A-B 324063 [1.99] A&B 184540 [2.29] B-A 103893 [2.60] Precision 36.3% Sensitivity 64.0%
 # This file contains information on how to process reference data sets.
 #
 # dataset - name of data set, this label will be printed.
 # type    - True Positives (TP) and False Positives (FP)
 #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively
 #         - annotation
 #           file is used for GENCODE annotation of frame shift and non frame shift Indels
 # filter  - filter applied to variants for this particular data set 
 # path    - path of indexed BCF file
 #dataset               type             filter                                 path
 1000g                  TP               N_ALLELE==2&&VTYPE==SNP                /net/fantasia/home/atks/ref/vt/grch37/1000G.v5.snps.indels.complex.svs.sites.bcf
 dbsnp                  TP               N_ALLELE==2&&VTYPE==SNP                /net/fantasia/home/atks/ref/vt/grch37/dbSNP138.snps.indels.complex.sites.bcf
 GENCODE_V19            cds_annotation   .                                      /net/fantasia/home/atks/ref/vt/grch37/gencode.v19.cds.bed.gz
 DUST                   cplx_annotation  .                                      /net/fantasia/home/atks/ref/vt/grch37/mdust.bed.gz
 usage : vt profile_snps [options] <in.vcf>
 options : -f  filter expression []
           -g  file containing list of reference datasets []
           -I  file containing list of intervals []
           -i  intervals []
           -r  reference sequence fasta file []
           -?  displays help

Profile Indels

Profile Indels. The reference data sets can be obtained from vt resource bundle.

  #profile indels found in mills.vcf
  vt profile_indels -g indel.reference.txt mills.vcf -r hs37d5.fa  -i 20
 #this is a sample output for indel profiling.
 # square brackets contain the ins/del ratio.  
 # for the FS/NFS field, that is the proportion of coding indels that are frame shifted.  
 # The numbers in curved bracket are the counts of frame shift and non frame shift indels respectively.
 data set
   No Indels :      46974 [0.89]
      FS/NFS :       0.26 (8/23) 
dbsnp A-B 30704 [0.92] A&B 16270 [0.83] B-A 2049488 [1.52] Precision 34.6% Sensitivity 0.8%
mills A-B 43234 [0.88] A&B 3740 [1.00] B-A 203278 [0.98] Precision 8.0% Sensitivity 1.8%
mills.chip A-B 46847 [0.89] A&B 127 [0.90] B-A 8777 [0.93] Precision 0.3% Sensitivity 1.4%
affy.exome.chip A-B 46911 [0.89] A&B 63 [0.43] B-A 33997 [0.47] Precision 0.1% Sensitivity 0.2%
 # This file contains information on how to process reference data sets.
 # dataset - name of data set, this label will be printed.
 # type    - True Positives (TP) and False Positives (FP).
 #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively.
 #         - annotation.
 #           file is used for GENCODE annotation of frame shift and non frame shift Indels.
 # filter  - filter applied to variants for this particular data set.
 # path    - path of indexed BCF file.
 #dataset     type            filter                       path
 1000g        TP              N_ALLELE==2&&VTYPE==INDEL    /net/fantasia/home/atks/ref/vt/grch37/1000G.snps_indels.sites.bcf
 mills        TP              N_ALLELE==2&&VTYPE==INDEL    /net/fantasia/home/atks/ref/vt/grch37/mills.208620indels.sites.bcf
 dbsnp        TP              N_ALLELE==2&&VTYPE==INDEL    /net/fantasia/home/atks/ref/vt/grch37/dbsnp.13147541variants.sites.bcf
 GENCODE_V19  cds_annotation  .                            /net/fantasia/home/atks/ref/vt/grch37/gencode.cds.bed.gz
 DUST         cplx_annotation .                            /net/fantasia/home/atks/ref/vt/grch37/mdust.bed.gz
 usage : vt profile_indels [options] <in.vcf>
 options : -g  file containing list of reference datasets []
           -I  file containing list of intervals []
           -i  intervals []
           -r  reference sequence fasta file []
           -?  displays help

Profile VNTRs

Profile VNTRs. The reference data sets can be obtained from vt resource bundle.

 #profiles a set of VNTRs
 vt profile_vntrs vntrs.sites.bcf -g vntr.reference.txt 
 
 profile_vntrs v0.5
 
   no VNTRs           5660874           #number of VNTRs in vntrs.sites.bcf
   no low complexity  2686460 (47.46%)  #number of VNTRs in low complexity region determined by MDUST
   no coding          17911 (0.32%)     #number of VNTRs in coding regions determined by GENCODE v7
   no redundant       1312209 (23.18%)  #number of VNTRs involved in overlapping with one another
trf_lobstr (1638516) #TRF based reference set used in lobSTR, motif lengths 1 to 6. A-B 3269285 #TRs specific to vntrs.sites.bcf A-B~ 1666185 #TRs in vntrs.sites.bcf that overlap partially with at least one TR in TRF(lobSTR) but does not overlap exactly with another TR. A&B1 725404 #TRs in vntrs.sites.bcf that overlap exactly with at least one TR in TRF(lobSTR) A&B2 723195 #TRs in TRF(lobSTR) that overlap exactly with at least one TR in vntrs.sites.bcf B-A~ 710075 #TRs in TRF(lobSTR) that overlap partially with at least one TR in vntrs.sites.bcf but does not overlap exactly with another TR. B-A 205246 #TRs specific to TRF(lobSTR) #note that the first 3 rows should sum up to the number of TRs in vntrs.sites.bcf #and the 4th to 6th rows should sum up to the number of TRs in TRF( lobSTR) #This basically allows us to see the m to n overlapping in overlapping TRs
trf_repeatseq (1624553) #TRF based reference set used in repeatseq, motif lengths 1 to 6. A-B 3291652 A-B~ 1650190 A&B1 719032 A&B2 716838 B-A~ 703948 B-A 203767
trf_vntrseek (230306) #TRF based reference set used in vntrseek, motif lengths 7 to 2000. A-B 5384453 A-B~ 271302 A&B1 5119 A&B2 4973 B-A~ 92496 B-A 132837
codis+ (15) #CODIS STRs + 2 STRs from PROMEGA A-B 5660794 A-B~ 79 A&B1 1 A&B2 1 B-A~ 14 B-A 0
 # This file contains information on how to process reference data sets.
 # dataset - name of data set, this label will be printed.
 # type    - True Positives (TP) and False Positives (FP).
 #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively.
 #         - annotation.
 #           file is used for GENCODE annotation of coding VNTRs.
 # filter  - filter applied to variants for this particular data set.
 # path    - path of indexed BCF file.
 #dataset      type            filter                       path
 trf_lobstr    TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.lobstr.sites.bcf
 trf_repeatseq TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.repeatseq.sites.bcf
 trf_vntrseek  TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/trf.vntrseek.sites.bcf
 codis+        TP              VTYPE==VNTR                  /net/fantasia/home/atks/ref/vt/grch37/codis.strs.sites.bcf
 GENCODE_V19   cds_annotation  .                            /net/fantasia/home/atks/ref/vt/grch37/gencode.v19.cds.bed.gz
 DUST          cplx_annotation .                              
 usage : vt profile_vntrs [options] <in.vcf>
 options : -g  file containing list of reference datasets []
           -I  file containing list of intervals []
           -i  intervals []
           -r  reference sequence fasta file []
           -?  displays help

Profile NA12878

Profile Mendelian errors

  #profile NA12878 overlap with broad knowledgebase and illumina platinum genomes for the file vt.genotypes.bcf for chromosome 20.
  vt profile_na12878  vt.genotypes.bcf -g na12878.reference.txt -r hs37d5.fa -i 20 
  #this is a sample output for mendelian error profiling.
  #R and A stand for reference and alternate allele respectively.
  #Error% - mendelian error (confounded with de novo mutation)
  #HomHet - Homozygous-Heterozygous genotype ratios
  #Het% - proportion of hets
    data set
   No Indels :      27770 [0.94]
      FS/NFS :       0.26 (8/23) 
broad.kb A-B 13071 [1.19] A&B 14699 [0.76] B-A 21546 [0.62] Precision 52.9% Sensitivity 40.6%
illumina.platinum A-B 17952 [0.88] A&B 9818 [1.07] B-A 2418 [0.88] Precision 35.4% Sensitivity 80.2%
broad.kb R/R R/A A/A ./. R/R 346 145 3 5473 R/A 3 4133 9 758 A/A 2 136 2186 956 ./. 2 139 86 322
Total genotype pairs : 6963 Concordance : 95.72% (6665) Discordance : 4.28% (298)
illumina.platinum R/R R/A A/A ./. R/R 1768 85 2 0 R/A 10 4479 14 0 A/A 13 180 3028 0 ./. 71 98 70 0
Total genotype pairs : 9579 Concordance : 96.83% (9275) Discordance : 3.17% (304)
  # This file contains information on how to process reference data sets.
  #
  # dataset - name of data set, this label will be printed.
  # type    - True Positives (TP) and False Positives (FP)
  #           overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively
  #         - annotation
  #           file is used for GENCODE annotation of frame shift and non frame shift Indels
  # filter  - filter applied to variants for this particular data set
  # path    - path of indexed BCF file
  #dataset              type         filter    path
  broad.kb              TP           PASS      /net/fantasia/home/atks/dev/vt/bundle/public/grch37/broad.kb.241365variants.genotypes.bcf
  illumina.platinum     TP           PASS      /net/fantasia/home/atks/dev/vt/bundle/public/grch37/NA12878.illumina.platinum.5284448variants.genotypes.bcf
  #gencode.v19           annotation   .         /net/fantasia/home/atks/dev/vt/bundle/public/grch37/gencode.v19.annotation.gtf.gz

profile_na12878 v0.5

 usage : vt profile_na12878 [options] <in.vcf>
 options : -g  file containing list of reference datasets []
           -I  file containing list of intervals []
           -i  intervals []
           -r  reference sequence fasta file []
           -?  displays help

Variant Calling

Discover

Discovers variants from reads in a BAM/CRAM file.

  #discover variants from NA12878.bam and write to stdout
  vt discover -b NA12878.bam -s NA12878 -r hs37d5.fa -i 20 
 usage : vt discover2 [options] 
 options : -b  input BAM/CRAM file
         -y  soft clipped unique sequences cutoff [0]
         -x  soft clipped mean quality cutoff [0]
         -w  insertion desired type II error [0.0]
         -c  insertion desired type I error [0.0]
         -h  insertion fractional evidence cutoff [0]
         -g  insertion count cutoff [1]
         -n  deletion desired type II error [0.0]
         -m  deletion desired type I error [0.0]
         -v  deletion fractional evidence cutoff [0]
         -u  deletion count cutoff [1]
         -k  snp desired type II error [0.0]
         -j  snp desired type I error [0.0]
         -f  snp fractional evidence cutoff [0]
         -e  snp evidence count cutoff [1]
         -q  base quality cutoff for bases [0]
         -C  likelihood ratio cutoff [0]
         -B  reference bias [0]
         -a  read exclude flag [0x0704]
         -l  ignore overlapping reads [false]
         -t  MAPQ cutoff for alignments [0]
         -p  ploidy [2]
         -s  sample ID
         -r  reference sequence fasta file []
         -o  output VCF file [-]
         -z  ignore MD tags [0]
         -d  debug [0]
         -I  file containing list of intervals []
         -i  intervals []
         -?  displays help

Merge candidate variants

Merge candidate variants across samples. Each VCF file is required to have the FORMAT flags E and N and should have exactly one sample.

  #merge candidate variants from VCFs in candidate.txt and output in candidate.sites.vcf
  vt merge_candidate_variants candidates.txt -o candidate.sites.vcf
 usage : vt merge_candidate_variants [options] 
 options : -L  file containing list of input VCF files
           -o  output VCF file [-]
           -I  file containing list of intervals []
           -i  intervals
           --  ignores the rest of the labeled arguments following this flag
           -h  displays help

Filter overlap

Removes overlapping variants in a VCF file by tagging such variants with the FILTER flag overlap.

  #annotates variants that are overlapping  
  vt filter_overlap in.vcf -r hs37d5.fa -o overlapped.tagged..vcf
 usage : vt filter_overlap [options] <in.vcf>
 options : -o  output VCF file [-]
           -w  window overlap for variants [0]
           -I  file containing list of intervals []
           -i  intervals []
           -?  displays help
  #Use Remove overlap instead for versions older than Jan 12, 2017
  vt remove_overlap in.vcf -r hs37d5.fa -o overlapped.tagged..vcf
   usage: vt remove_overlap [options] <in.vcf>
   The old version has the same options except that it lacks the -w option
   The change occurred in the following commit:
   https://github.com/atks/vt/commit/ab5cf7e91b3baa5349f439e6fe92491ae19da1a6

Annotate Indels

Annotates indels with VNTR information and adds a VNTR record. Facilitates the simultaneous calling of VNTR together with Indels and SNPs.

  #annotates indels from VCFs with VNTR information.
  vt annotate_indels in.vcf -r hs37d5.fa -o annotated.sites.vcf
 CHROM   POS     ID      REF     ALT     QUAL    FILTER  INFO
 20      82079   .       G       A       1255.98 .       NSAMPLES=1;E=43;N=51;ESUM=43;NSUM=51;FLANKSEQ=GGAGCACGCC[G/A]CCATGCCCGG
 20      82217   .       G       A       1632.77 .       NSAMPLES=1;E=56;N=61;ESUM=56;NSUM=61;FLANKSEQ=GAGCCACCGC[G/A]CCCGGCCCAG
 20      83250   .       CTGTGTGTG       C       .       .       NSAMPLES=1;E=18;N=35;ESUM=18;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:<VNTR>:GT
 20      83250   .       CTGTGTGTGTG     C       .       .       NSAMPLES=1;E=3;N=35;ESUM=3;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:<VNTR>:GT
 20      83251   .       TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG    <VNTR>  .       .       MOTIF=GT;RU=TG;FZ_CONCORDANCE=1;FZ_RL=52;FZ_LL=0;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FZ_RU_COUNTS=26,26;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG]TTTAGTATTT
 20      83252   .       G       C       359.204 .       NSAMPLES=1;E=13;N=14;ESUM=13;NSUM=14;FLANKSEQ=CTCTCTCTCT[G/C]TGTGTGTGTG
 20      83260   .       G       C       500.163 .       NSAMPLES=1;E=18;N=34;ESUM=18;NSUM=34;FLANKSEQ=CTGTGTGTGT[G/C]TGTGTGTGTG
 20      83267   .       T       C       247.043 .       NSAMPLES=1;E=11;N=43;ESUM=11;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT
 20      83275   .       T       C       609.669 .       NSAMPLES=1;E=24;N=43;ESUM=24;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT
 20      90008   .       C       A       1546.88 .       NSAMPLES=1;E=52;N=60;ESUM=52;NSUM=60;FLANKSEQ=AACAGAAAAC[C/A]AAATACTGTA
 20      91088   .       C       T       1766.04 .       NSAMPLES=1;E=58;N=66;ESUM=58;NSUM=66;FLANKSEQ=CCCAGCATAC[C/T]ATGGTTGTGC
 20      91508   .       G       A       1266.93 .       NSAMPLES=1;E=44;N=53;ESUM=44;NSUM=53;FLANKSEQ=AATTAGTAAG[G/A]CTTACGTAAG
 20      91707   .       C       T       888.134 .       NSAMPLES=1;E=30;N=53;ESUM=30;NSUM=53;FLANKSEQ=TGATTTTCTA[C/T]AGCAGGACCT
 20      92527   .       A       G       828.593 .       NSAMPLES=1;E=34;N=40;ESUM=34;NSUM=40;FLANKSEQ=ATTAATTGCC[A/G]TTCTCTCTTT
 20      93440   .       A       G       688.144 .       NSAMPLES=1;E=24;N=58;ESUM=24;NSUM=58;FLANKSEQ=TTGGATGCAT[A/G]GTCTGTAAAT
 20      93636   .       TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT     <VNTR>  .       .       MOTIF=T;RU=T;FZ_CONCORDANCE=0.939394;FZ_RL=35;FZ_LL=0;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FZ_RU_COUNTS=31,33;FLANKSEQ=TCTAGGATTC[TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT
 20      93646   .       C       CT      .       .       NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FLANKSEQ=TTTTTCTTTC[TTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT;GMOTIF=T;TR=20:93636:TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT:<VNTR>:T
 20      93717   .       A       T       31.7622 .       NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKSEQ=CAGTGGCGTG[A/T]TCTTAGATCA
 20      93931   .       G       A       628.149 .       NSAMPLES=1;E=22;N=53;ESUM=22;NSUM=53;FLANKSEQ=GATTACAGGT[G/A]TGAGCCGCTG
 20      100699  .       C       T       809.09  .       NSAMPLES=1;E=28;N=61;ESUM=28;NSUM=61;FLANKSEQ=GGTGAAAAAT[C/T]ACCTGTCAGT
 20      101362  .       G       A       1087.13 .       NSAMPLES=1;E=36;N=67;ESUM=36;NSUM=67;FLANKSEQ=TAATACTGAA[G/A]TTTACTTCTC
 The following shows the trace of how the algorithm works
   ============================================
   ANNOTATING INDEL FUZZILY
   ********************************************
   EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT
   
   20:131948:C/CCA
   EXACT REGION 131948-131965 (18) 
                CCACACACACACACACAA
   FINAL EXACT REGION 131948-131965 (18) 
                      CCACACACACACACACAA
   ********************************************
   PICK CANDIDATE MOTIFS
   
   Longest Allele : C[CA]CACACACACACACACAA
   detecting motifs for an str
   seq: CCACACACACACACACACAA
   len : 20
   cmax_len : 10
   candidate motifs: 25
   AC : 0.894737 2 0
   AAC : 0.5 3 0.0555556
   ACC : 0.5 3 0.0555556
   AAAC : 0.0588235 4 0.125 (< 2 copies)
   ACCC : 0.0588235 4 0.125 (< 2 copies)
   AACAC : 0.5 5 0.02
   ACACC : 0.5 5 0.02
   AAACAC : 0.0666667 6 0.0555556 (< 2 copies)
   ACACCC : 0.0666667 6 0.0555556 (< 2 copies)
   AACACAC : 0.5 7 0.0102041
   ACACACC : 0.5 7 0.0102041
   AAACACAC : 0.0769231 8 0.03125 (< 2 copies)
   ACACACCC : 0.0769231 8 0.03125 (< 2 copies)
   AACACACAC : 0.5 9 0.00617284 (< 2 copies)
   ACACACACC : 0.5 9 0.00617284 (< 2 copies)
   AAACACACAC : 0.0909091 10 0.02 (< 2 copies)
   ACACACACCC : 0.0909091 10 0.02 (< 2 copies)
   ********************************************
   PICKING NEXT BEST MOTIF
   
   selected:         AC 0.89 0.00
   ********************************************
   DETECTING REPEAT TRACT FUZZILY
   ++++++++++++++++++++++++++++++++++++++++++++
   Exact left/right alignment
   
   repeat_tract              : CACACACACACACACA
   position                  : [131949,131964]
   motif_concordance         : 1
   repeat units              : 8
   exact repeat units        : 8
   total no. of repeat units : 8
   
   ++++++++++++++++++++++++++++++++++++++++++++
   Fuzzy right alignment
   
   repeat motif : CA
   rflank       : AACTC
   mlen         : 2
   rflen        : 5
   plen         : 111
   
   read         : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC
   rlen         : 106
   
   optimal score: 50.5073
   optimal state: MR
   optimal track: MR|r|0|5
   optimal probe len: 25
   optimal path length : 107
   max j: 106
   probe: (1~82) [1~10] (1~5)
   read : (1~82) [83~101] (102~106)
   
   motif #           : 10 [83,101]
   motif concordance : 95% (9/10)
   motif discordance : 0|1|0|0|0|0|0|0|0|0
   
   Model:  ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC 
          SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME
                                                                                             oo++oo++oo++oo++oo++RRRRR 
   Read:   AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC 
   
   ++++++++++++++++++++++++++++++++++++++++++++
   Fuzzy left alignment
   
   lflank       : ATCTTA
   repeat motif : CA
   lflen        : 6
   mlen         : 2
   plen         : 111
   
   read         : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT
   rlen         : 105
   
   optimal score: 50.5858
   optimal state: Z
   optimal track: Z|m|10|2
   optimal probe len: 26
   optimal path length : 106
   max j: 105
   mismatch penalty: 3
   
   model: (1~6) [1~10]
   read : (1~6) [7~25][26~106]
   
   motif #           : 10 [7,25]
   motif concordance : 95% (9/10)
   motif discordance : 0|1|0|0|0|0|0|0|0|0
   
   Model:  ATCTTACACACACACACACACACACA-------------------------------------------------------------------------------- 
          SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE
           LLLLLLoo++oo++oo++oo++oo++                                                                                 
   Read:   ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT 
   
   xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
   VNTR Summary
   rid          : 19
   motif        : AC
   ru           : CA
   
   Exact
   repeat_tract                    : CACACACACACACACA
   position                        : [131949,131964]
   reference repeat unit length    : 8
   motif_concordance               : 1
   repeat units                    : 8
   exact repeat units              : 8
   total no. of repeat units       : 8
   
   Fuzzy
   repeat_tract                    : CACCACACACACACACACA
   position                        : [131946,131964]
   reference repeat unit length    : 19
   motif_concordance               : 0.95
   repeat units                    : 19
   exact repeat units              : 9
   total no. of repeat units       : 10
   xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
 usage : vt annotate_indels [options] <in.vcf>
 options : -v  add vntr record [false]
           -x  override tags [false]
           -f  filter expression []
           -d  debug [false]
           -m  mode [f]
               e : by exact alignment              f : by fuzzy alignment
           -c  classification schemas of tandem repeat [6]
               1 : lai2003     
               2 : kelkar2008  
               3 : fondon2012  
               4 : ananda2013  
               5 : willems2014 
               6 : tan_kang2015
           -a  annotation type [v]
               v : a. output VNTR variant (defined by classification).
                      RU                    repeat unit on reference sequence (CA)
                      MOTIF                 canonical representation (AC)
                      RL                    repeat tract length in bases (11)
                      FLANKS                flanking positions of repeat tract determined by exact alignment
                      RU_COUNTS             number of exact repeat units and total number of repeat units in
                                            repeat tract determined by exact alignment
                      FZ_RL                 fuzzy repeat tract length in bases (11)
                      FZ_FLANKS             flanking positions of repeat tract determined by fuzzy alignment
                      FZ_RU_COUNTS          number of exact repeat units and total number of repeat units in
                                            repeat tract determined by fuzzy alignment
                      FLANKSEQ              flanking sequence of indel
                      LARGE_REPEAT_REGION   repeat region exceeding 2000bp
                   b. mark indels with overlapping VNTR.
                      FLANKS       flanking positions of repeat tract determined by exact alignment
                      FZ_FLANKS    flanking positions of repeat tract determined by fuzzy alignment
                      GMOTIF       generating motif used in fuzzy alignment
                      TR    position and alleles of VNTR (20:23413:CACACACACAC:<VNTR>)
               a : annotate each indel with RU, RL, MOTIF, REF.
           -r  reference sequence fasta file []
           -o  output VCF file [-]
           -I  file containing list of intervals []
           -i  intervals
           -?  displays help

Construct Probes

Construct probes for genotyping a variant.

  #construct probes from candidate.sites.bcf and output to standard out
  vt construct_probes candidates.sites.bcf -r ref.fa
 usage : vt construct_probes [options] <in.vcf>
 options : -o  output VCF file [-]
           -f  minimum flank length [20]
           -r  reference sequence fasta file []
           -I  file containing list of intervals []
           -i  intervals []
           --  ignores the rest of the labeled arguments following this flag
           -h  displays help

Genotype

Genotypes variants for each sample.

  #genotypes variants found in candidate.sites.vcf from sample.bam
  vt genotype -r seq.fa -b sample.bam -i candidates.sites.vcf -o sample.sites.vcf
 usage : vt genotype [options] 
 options : -r  reference sequence fasta file []
           -s  sample ID []
           -o  output VCF file [-]
           -b  input BAM file []
           -i  input candidate VCF file []
           --  ignores the rest of the labeled arguments following this flag
           -h  displays help

Pedigree File

  vt understands an augmented version introduced by Hyun of the PED described by plink.
  The pedigree file format is as follows with the following mandatory fields:
        
Field Description Valid Values Missing Values
Family ID

Individual ID
Paternal ID
Maternal ID
Sex
Phenotype

ID of this family

ID(s) of this individual (comma separated)
ID of the father
ID of the mother
Sex of the individual
Phenotype

[A-Za-z0-9_]+

[A-Za-z0-9_]+(,[A-Za-z0-9_]+)*
[A-Za-z0-9_]+
[A-Za-z0-9_]+
1=male, 2=female, other, male, female
[A-Za-z0-9_]+

0

cannot be missing
0
0
other
-9

 Examples:     
    ceu      NA12878    NA12891     NA12892     female    -9
    yri      NA19240    NA19239     NA19238     female    -9
    ceu      NA12878    NA12891     NA12892     2     -9
    yri      NA19240    NA19239     NA19238     2     -9
    #allows tools like profile_mendelian to detect duplicates and check for concordance
    ceu      NA12878,NA12878A    NA12891     NA12892     female   case
    yri      NA19240             NA19239     NA19238     female   control
    #allows tools like profile_mendelian to detect duplicates and check for concordance
    ceu      NA12412    0  0     female  case
    yri      NA19650    0  0     female  control

Resource Bundle

GRCh37

Files are based on hs37d5.fa made by Heng Li.

Read here for contents.

GRCh38

Files are based on hs38DH.fa made by Heng Li. Note that many of the references are simply lifted over from GRCh37 using Picard's liftover tool with the default options.

Read here for contents.

FAQ

1. vt cannot retrieve sequences from my reference sequence file

 It is common to use reference files based on the UCSC browser's database and from the Genome Reference Consortium.
 For example, HG19 vs Grch37.  The key difference is that chromosome 1 is represented as chr1 and 1 respectively in the 
 FASTA files from these 2 sources.  Just use the appropriate FASTA file that was used to generate your VCF file originally.
 Another common issue is due to the corruption of the index file of the reference sequence; say for a reference file named
 hs37d5.fa or hs37d5.fa.gz, simply delete the index file denoted by hs37d5.fa.fai or hs37d5.fa.gz.fai and run the vt command 
 again.  A new index file will be generated automatically.

How to cite vt?

If you use normalize:
Adrian Tan, Gonçalo R. Abecasis and Hyun Min Kang. Unified Representation of Genetic Variants. Bioinformatics (2015) 31(13): 2202-2204

Maintained by

This page is maintained by Adrian