Difference between revisions of "Vt"
(→Annotate Indels) |
(→Annotate Indels) |
||
Line 1,201: | Line 1,201: | ||
20 100699 . C T 809.09 . NSAMPLES=1;E=28;N=61;ESUM=28;NSUM=61;FLANKSEQ=GGTGAAAAAT[C/T]ACCTGTCAGT | 20 100699 . C T 809.09 . NSAMPLES=1;E=28;N=61;ESUM=28;NSUM=61;FLANKSEQ=GGTGAAAAAT[C/T]ACCTGTCAGT | ||
20 101362 . G A 1087.13 . NSAMPLES=1;E=36;N=67;ESUM=36;NSUM=67;FLANKSEQ=TAATACTGAA[G/A]TTTACTTCTC | 20 101362 . G A 1087.13 . NSAMPLES=1;E=36;N=67;ESUM=36;NSUM=67;FLANKSEQ=TAATACTGAA[G/A]TTTACTTCTC | ||
+ | |||
+ | The following shows the trace of how the algorithm works | ||
+ | |||
+ | ============================================ | ||
+ | ANNOTATING INDEL FUZZILY | ||
+ | ******************************************** | ||
+ | EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT | ||
+ | |||
+ | 20:131948:C/CCA | ||
+ | EXACT REGION 131948-131965 (18) | ||
+ | CCACACACACACACACAA | ||
+ | FINAL EXACT REGION 131948-131965 (18) | ||
+ | CCACACACACACACACAA | ||
+ | ******************************************** | ||
+ | PICK CANDIDATE MOTIFS | ||
+ | |||
+ | Longest Allele : C[CA]CACACACACACACACAA | ||
+ | detecting motifs for an str | ||
+ | seq: CCACACACACACACACACAA | ||
+ | len : 20 | ||
+ | cmax_len : 10 | ||
+ | candidate motifs: 25 | ||
+ | AC : 0.894737 2 0 | ||
+ | AAC : 0.5 3 0.0555556 | ||
+ | ACC : 0.5 3 0.0555556 | ||
+ | AAAC : 0.0588235 4 0.125 (< 2 copies) | ||
+ | ACCC : 0.0588235 4 0.125 (< 2 copies) | ||
+ | AACAC : 0.5 5 0.02 | ||
+ | ACACC : 0.5 5 0.02 | ||
+ | AAACAC : 0.0666667 6 0.0555556 (< 2 copies) | ||
+ | ACACCC : 0.0666667 6 0.0555556 (< 2 copies) | ||
+ | AACACAC : 0.5 7 0.0102041 | ||
+ | ACACACC : 0.5 7 0.0102041 | ||
+ | AAACACAC : 0.0769231 8 0.03125 (< 2 copies) | ||
+ | ACACACCC : 0.0769231 8 0.03125 (< 2 copies) | ||
+ | AACACACAC : 0.5 9 0.00617284 (< 2 copies) | ||
+ | ACACACACC : 0.5 9 0.00617284 (< 2 copies) | ||
+ | AAACACACAC : 0.0909091 10 0.02 (< 2 copies) | ||
+ | ACACACACCC : 0.0909091 10 0.02 (< 2 copies) | ||
+ | ******************************************** | ||
+ | PICKING NEXT BEST MOTIF | ||
+ | |||
+ | selected: AC 0.89 0.00 | ||
+ | selected: AC 0.89 0.00 | ||
+ | ******************************************** | ||
+ | 4. DETECTING REPEAT TRACT FUZZILY | ||
+ | ++++++++++++++++++++++++++++++++++++++++++++ | ||
+ | 4a. Exact left/right alignment | ||
+ | |||
+ | repeat_tract : CACACACACACACACA | ||
+ | position : [131949,131964] | ||
+ | motif_concordance : 1 | ||
+ | repeat units : 8 | ||
+ | exact repeat units : 8 | ||
+ | total no. of repeat units : 8 | ||
+ | |||
+ | ++++++++++++++++++++++++++++++++++++++++++++ | ||
+ | 4a. Fuzzy right alignment | ||
+ | 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)[[User:Atks|Atks]] ([[User talk:Atks|talk]]) 17:00, 5 October 2015 (EDT) | ||
+ | |||
+ | repeat motif : CA | ||
+ | rflank : AACTC | ||
+ | mlen : 2 | ||
+ | rflen : 5 | ||
+ | plen : 111 | ||
+ | |||
+ | read : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC | ||
+ | rlen : 106 | ||
+ | |||
+ | optimal score: 50.5073 | ||
+ | optimal state: MR | ||
+ | optimal track: MR|r|0|5 | ||
+ | optimal probe len: 25 | ||
+ | optimal path length : 107 | ||
+ | max j: 106 | ||
+ | probe: (1~82) [1~10] (1~5) | ||
+ | read : (1~82) [83~101] (102~106) | ||
+ | |||
+ | motif # : 10 [83,101] | ||
+ | motif concordance : 0.95% (9/10) | ||
+ | motif discordance : 0|1|0|0|0|0|0|0|0|0 | ||
+ | |||
+ | Model: ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC | ||
+ | SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME | ||
+ | oo++oo++oo++oo++oo++RRRRR | ||
+ | Read: AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC | ||
+ | 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)[[User:Atks|Atks]] ([[User talk:Atks|talk]]) 17:00, 5 October 2015 (EDT) | ||
+ | |||
+ | ++++++++++++++++++++++++++++++++++++++++++++ | ||
+ | 4b. Fuzzy left alignment | ||
+ | 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)[[User:Atks|Atks]] ([[User talk:Atks|talk]]) 17:00, 5 October 2015 (EDT) | ||
+ | |||
+ | QUAL+33 MATCH MISMATCH PENALTY | ||
+ | 42 2.10001 -5.10001 -2.10001 | ||
+ | |||
+ | lflank : ATCTTA | ||
+ | repeat motif : CA | ||
+ | lflen : 6 | ||
+ | mlen : 2 | ||
+ | plen : 111 | ||
+ | |||
+ | read : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT | ||
+ | rlen : 105 | ||
+ | |||
+ | optimal score: 50.5858 | ||
+ | optimal state: Z | ||
+ | optimal track: Z|m|10|2 | ||
+ | optimal probe len: 26 | ||
+ | optimal path length : 106 | ||
+ | max j: 105 | ||
+ | mismatch penalty: 3 | ||
+ | |||
+ | model: (1~6) [1~10] | ||
+ | read : (1~6) [7~25][26~106] | ||
+ | |||
+ | motif # : 10 [7,25] | ||
+ | motif concordance : 0.95% (9/10) | ||
+ | motif discordance : 0|1|0|0|0|0|0|0|0|0 | ||
+ | |||
+ | Model: ATCTTACACACACACACACACACACA-------------------------------------------------------------------------------- | ||
+ | SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE | ||
+ | LLLLLLoo++oo++oo++oo++oo++ | ||
+ | Read: ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT | ||
+ | 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)[[User:Atks|Atks]] ([[User talk:Atks|talk]]) 17:00, 5 October 2015 (EDT) | ||
+ | |||
+ | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
+ | VNTR Summary | ||
+ | rid : 19 | ||
+ | motif : AC | ||
+ | ru : CA | ||
+ | |||
+ | Exact | ||
+ | repeat_tract : CACACACACACACACA | ||
+ | position : [131949,131964] | ||
+ | reference repeat unit length : 8 | ||
+ | longest allele length : 4.55884e-41 | ||
+ | motif_concordance : 1 | ||
+ | repeat units : 8 | ||
+ | exact repeat units : 8 | ||
+ | total no. of repeat units : 8 | ||
+ | |||
+ | Fuzzy | ||
+ | repeat_tract : CACCACACACACACACACA | ||
+ | position : [131946,131964] | ||
+ | reference repeat unit length : 19 | ||
+ | longest allele length : 0 | ||
+ | motif_concordance : 0.95 | ||
+ | repeat units : 19 | ||
+ | exact repeat units : 9 | ||
+ | total no. of repeat units : 10 | ||
+ | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
<div class="mw-collapsible-content"> | <div class="mw-collapsible-content"> |
Revision as of 17:00, 5 October 2015
Contents
Introduction
vt is a variant tool set that discovers short variants from Next Generation Sequencing data. The features are being rolled out to github as major rewriting is being undertaken.
Installation
The source files are housed in github. htslib is used and a copy of a developmental freeze is stored as part of the vt repository to ensure compatibility.
To install, perform the following steps:
#this will create a directory named vt in the directory you cloned the repository 1. git clone https://github.com/atks/vt.git
#change directory to vt 2. cd vt
#run make, note that compilers need to support the c++0x standard 3. make
#you can test the build (Acknowledgements to holtgrewe@github for helping out with this.) 4. make test
Building has been tested on Linux and Mac systems on gcc 4.8.1 and clang 3.4.
Updating
vt is currently under heavy development, you will probably need to update often.
#remove all object files #you need to do this as source files as the static libraries might have changed and need to be removed. 1. make clean
#update source files 2. git pull
#compile and link, the -j option tells Makefile to run up to 40 independent commands in parallel 3. make -j 40
General Features
Common options
-i multiple intervals in <seq>:<start>-<end> format delimited by commas.
-I multiple intervals in <seq>:<start>-<end> format listed in a text file line by line.
-o defines the out file which and has the STDOUT set as the default. You may modify the STDOUT to output the binary version of the format. Uncompressed VCF and BCF streams are indicated by - and + respectively.
-f filter expression
-s sequential region selection as opposed to random access of regions specified by the i option. This is useful when you want to select many close-by regions, while the -i option works, it is less efficient and also selects a variant multiple times if it overlaps 2 regions. This option iterates through the variants in the file sequentially and checks for overlap with the bed file given.
Uncompressed BCF streams
htslib is designed with BCF as the underlying data structure and it has incorporated awareness of uncompressed BCF streams in the i/o API. One may use this feature to stream uncompressed BCF records to save on computational time spent on (de)compression.
#using textual VCF streams indicated by - cat mills.vcf | vt normalize - -r hs37d5.fa | vt uniq - -o out.bcf
#using uncompressed BCF streams indicated by + cat mills.vcf | vt normalize - -r hs37d5.fa -o + | vt uniq + -o out.bcf
In this example, the former took 0.84s while the latter took 0.64s to process. (24% speed up!)
Filters
For some programs. you may define a filter via the -f option.
This allows you to only analyse biallelic indels that are passed on chromosome 20. vt profile_na12878 vt.bcf -g na12878.reference.txt -r genome.fa -f "N_ALLELE==2&&VTYPE==INDEL&&PASS" -i 20
Other examples of filters
#all variants with a SNP in them VTYPE&SNP #Simple insertions of length 1 VTYPE==INDEL&&DLEN==1 #Indels of length 1 VTYPE==INDEL&&LEN==1
Variant characteristics VTYPE,N_ALLELE,DLEN,LEN
Variant value types SNP,MNP,INDEL,CLUMPED
Biallelic SNPs only : VTYPE==SNP&&N_ALLELE==2 Biallelic Indels with embedded SNP : VTYPE==(SNP|INDEL)&&N_ALLELE==2 Biallelic variants involving insertions : VTYPE&INDEL&&DLEN>0&&N_ALLELE==2 Biallelic variants involving 1bp variants : LEN==1&&N_ALLELE==2
QUAL field QUAL
FILTER fields PASS, FILTER.<tag>
INFO fields INFO.<tag>
Passed biallelic SNPs only : PASS&&VTYPE==SNP&&N_ALLELE==2 Passed Common biallelic SNPs only : PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005 Passed Common biallelic SNPs or rare indels : (PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005)||(VTYPE&INDEL&&INFO.AF<=0.005) Passed Common biallelic SNPs or rare indels : ((PASS&&VTYPE==SNP&&N_ALLELE==2&&INFO.AF>0.005)||(VTYPE&INDEL&&INFO.AF<=0.005))&&QUAL>100 with quality greater than 100 Failed rare variants : ~PASS&&(INFO.AC/INFO.AN<0.005)
Regular expression matching PERL style (implemented with pcre2) Sometimes, an info field will contain several values in a string with functional annotation, to match what you want, just use INFO.ANNO=~'<perl regular expression>'
Passed variants in intergenic regions or UTR : PASS&&INFO.ANNO=~'Intergenic|UTR' Passed variants in intergenic regions or UTR ignoring case : PASS&&INFO.ANNO=~'(?i)Intergenic|UTR'
pcre2's '(?i)Intergenic|UTR' is equivalent to PERL's '/intergenic|UTR/i'
Operations == : equivalence for strings and numbers != : not equal =~ : regular expression match for strings only ~~ : not of =~. Is equivalent to PERL's !~, this notation is used as BASH keeps interpreting ! for recalling commands from the history ~ : logical not && : logical and || : logical or & : bitwise and | : bitwise or + : add - : subtract * : multiply / : divide
The following programs support filter expressions.
- view
- peek
- profile_snps
- profile_indels
- profile_na12878
- profile_mendelian
- profile_len
- profile_chrom
- profile_afs
- profile_hwe
- concordance
- partition
Alternate headers
As BCF is a restrictive format of VCF where all meta data must be present in the header, vt provides a mechanism to read an alternative header for VCF files that do not have a well formed header. Simply provide a header file stub named as <vcf-file>.hdr and vt will automatically read it instead of the original header in <vcf-file>.
For more information about VCF/BCF : http://samtools.github.io/hts-specs/VCFv4.2.pdf
This mechanism is available only if one is reading VCF or compressed VCF files. It is
disabled for BCF files as this might corrupt the BCF file because the encoding of the
fields in BCF records is based on the order of the meta info lines in the header.
Note: BCF2.2 introduces the IDX field in meta information lines that indicates the
dictionary encoding. This feature might be enabled for BCF files in the future.
General cases of Ploidy and Alleles
I am trying to make vt handle general cases of ploidy and alleles. Please let me know if that is lacking in a tool that you are using.
VCF Manipulation
View
Views a VCF or VCF.GZ or BCF file.
#views mills.bcf and outputs to standard out vt view -h mills.bcf #views mills.bcf and locally sorts it in a 10000bp window and outputs to out.bcf vt view -h -w 10000 mills.bcf
usage : vt view [options] <in.vcf>
options : -o output VCF/VCF.GZ/BCF file [-] -w local sorting window size [0] -s print site information only without genotypes [false] -h print header [false] -p print options and summary [] -I file containing list of intervals [] -i intervals [] -? displays help
Index
Indexes a VCF.GZ or BCF file.
#indexes mills.bcf vt index mills.bcf #indexes mills.vcf.gz vt index mills.vcf.gz
usage : vt index [options] <in.vcf>
options : -p print options and summary [] -- ignores the rest of the labeled arguments following this flag -h displays help
Sorting
Sorting may be done in 3 approaches.
Locally:
Performs sorting within a local window. The window size may be set by the -w option. The default window size
is 1000bp and if a record is detected to be potentially out of order due to a small window size, it wil be reported.
Use this when your VCF records are grouped by chromosome but not ordered in short stretches.
By chromosome:
Your VCF file is not ordered by the chromosomes in the header but is fully ordered within each chromosome.
The VCF file should be indexed and vt will output the records in the order of chromosomes given in the header.
Full sort [default option]:
No assumptions are made about the VCF file. Records will be ordered by the order of contigs in the header.
Smaller temporary ordered files are created and their names are <output_vcf>.<no>.bcf and after generating
these files, they are merged and output into <output_vcf>.
#sorts mills.bcf and outputs to standard out in a 1000bp window. vt sort -m local mills.bcf #sorts mills.bcf and locally sorts it in a 10000bp window and outputs to out.bcf vt sort -m local -w 10000 mills.bcf -o out.bcf #sorts an indexed mills.bcf with chromosomes not sorted in the contig order in the header vt sort -m chrom mills.bcf -o out.bcf #sorts mills.bcf with no assumption vt sort mills.bcf -o out.bcf
usage : vt sort [options] <in.vcf>
options : -m sorting modes. [full] local : locally sort within a 1000bp window. Window size may be set by -w. chrom : sort chromosomes based on order of contigs in header. input must be indexed. full : full sort with no assumptions. -o output VCF/VCF.GZ/BCF file. [-] -w local sorting window size, set by default to 1000 under local mode. [0] -p print options and summary. [] -? displays help
Normalization
Normalize variants in a VCF file (Tan et al. 2015) . Normalized variants may have their positions changed; in such cases, the normalized variants are reordered and output in an ordered fashion. The local reordering takes place over a window of 10000 base pairs which may be changed via the -w option. There is an underlying assumption that the REF field is consistent with the reference sequence use, vt will check for this and will fail if reference inconsistency is encountered; this may be relaexd with the -n option.
#normalize variants and write out to dbsnp.normalized.vcf vt normalize dbsnp.vcf -r seq.fa -o dbsnp.normalized.vcf
#normalize variants, send to standard out and remove duplicates. vt normalize dbsnp.vcf -r seq.fa | vt uniq - -o dbsnp.normalized.uniq.vcf
#variants that are normalized will be annotated with an OLD_VARIANT info tag. #CHROM POS ID REF ALT QUAL FILTER INFO 19 29238772 . C G . PASS VT=SNP;OLD_VARIANT=19:29238771:TC/TG 20 60674709 . GCCCAGCCCCAC G . PASS VT=INDEL;OLD_VARIANT=20:60674718:CACCCCAGCCCC/C
#this shows a sample output with the normalization operations that were used #categorized into 5 categories each for biallelic and multiallelic variants.
stats: biallelic no. left trimmed : 156908 no. right trimmed : 323 no. left and right trimmed : 33 no. right trimmed and left aligned : 7 no. left aligned : 12360
total no. biallelic normalized : 169631
multiallelic no. left trimmed : 627189 no. right trimmed : 2509 no. left and right trimmed : 1498 no. right trimmed and left aligned : 212 no. left aligned : 1783
total no. multiallelic normalized : 633191
total no. variants normalized : 802822 total no. variants observed : 88052639
usage : vt normalize [options] <in.vcf>
options : -o output VCF file [-] -d debug [false] -q do not print options and summary [false] -n do not fail when REF is inconsistent with reference sequence for non SNPs [false] -w window size for local sorting of variants [10000] -I file containing list of intervals [] -i intervals [] -r reference sequence fasta file [] -? displays help
Decompose biallelic block substitutions
Decomposes biallelic block substitutions into its constituent SNPs.
There is now an additional option -a which decomposes non block substitutions into its constituent SNPs and indels. (kindly added by [holtgrewe@github])
There is no exact solution and this decomposition is based on the best guess outcome using a Needleman-Wunsch algorithm.
todo: rename program?
#decomposes biallelic block substitutions and write out to decomposed_blocksub.vcf vt decompose_blocksub gatk.vcf -o decomposed_blocksub.vcf
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . CA TG 50340.1 PASS AC=1;AN=2 GT 0|1
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . C T 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CA/TG GT 0|1 20 763838 . A G 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CA/TG GT 0|1
#decomposes biallelic clumped variant and write out to decomposed_blocksub.vcf vt decompose_blocksub -a gatk.vcf -o decomposed_blocksub.vcf
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . CG TGA 50340.1 PASS AC=1;AN=2 GT 0|1
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 20 763837 . C T 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1 20 763838 . G GA 50340.1 PASS AC=1;AN=2;OLD_CLUMPED=20:763837:CG/TGA GT 0|1
description : decomposes biallelic block substitutions into its constituent SNPs.
usage : vt decompose_blocksub [options] <in.vcf>
options : -a enable aggressive/alignment mode -o output VCF file [-] -I file containing list of intervals [] -i intervals [] -? displays help
Decompose
Decompose multiallelic variants in a VCF file. If the VCF file has genotype fields GT,PL, GL or DP, they are modified to reflect the change in alleles. All other genotype fields are removed. The -s option will retain the fields and decompose fields of counts R and A accordingingly.
Decomposition and combining variants is a complex operation where the correctness is dependent on [tfarrah@github]:
- whether the observed variants are seen in the same sample,
- if same sample, whether they are homozygous or heterozygous,
- if both heterozygous, whether they are in the same haplotype or not (if known).
and one should be aware of the issues in handling variants resulting from such operations.
The original purpose of this tool is to allow for allelic comparisons between call sets.
[example of a problem caused in combining separate variant records]
#decomposes multiallelic variants into biallelic variants and write out to gatk.decomposed.vcf vt decompose gatk.vcf -o gatk.decomposed.vcf
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA,TAAA,T . PASS AF=0.342,0.173,0.037 GT:DP:PL 1/2:81:281,5,9,58,0,115,338,46,116,809 0/0:86:0,30,323,31,365,483,38,291,325,567
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA . PASS OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL 1/.:281,5,9 0/0:0,30,323 1 3759889 . TA TAAA . . OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./1:281,58,115 0/0:0,31,483 1 3759889 . TA T . . OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./.:281,338,809 0/0:0,38,567
One might want to post process the partial genotypes like 1/. to the best guess genotype based on the PL values.
#decomposes multiallelic variants into biallelic variants and write out to gatk.decomposed.vcf with the -s option. #-s option splits up INFO and GENOTYPE fields that have number counts of R and A [VCFv4.2 section 1.2.2] appropriately. vt decompose -s gatk.vcf -o gatk.decomposed.vcf
#before decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA,TAAA,T . PASS AF=0.342,0.173,0.037 GT:DP:PL 1/2:81:281,5,9,58,0,115,338,46,116,809 0/0:86:0,30,323,31,365,483,38,291,325,567
#after decomposition #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 1 3759889 . TA TAA . PASS AF=0.342;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL 1/.:281,5,9 0/0:0,30,323 1 3759889 . TA TAAA . . AF=0.173;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./1:281,58,115 0/0:0,31,483 1 3759889 . TA T . . AF=0.037;OLD_MULTIALLELIC=1:3759889:TA/TAA/TAAA/T GT:PL ./.:281,338,809 0/0:0,38,567
In general, you should recompute fields that involves alleles after decomposition. Information is generally lost after vertically decomposing a variant, so care should be taken in interpreting the resultant values.
description : decomposes multiallelic variants into biallelic in a VCF file.
usage : vt decompose [options] <in.vcf>
options : -s smart decomposition [false] -o output VCF file [-] -I file containing list of intervals [] -i intervals [] -? displays help
Drop duplicate variants
Drops duplicate variants that appear later in the file.
If there are OLD_VARIANT tags in the INFO field, the variants in these tags are aggregated in the unique record retained.
#drop duplicate variants and save output in mills.uniq.vcf vt uniq mills.vcf -o mills.uniq.vcf
usage : vt uniq [options] <in.vcf>
options : -o output VCF file [-] -I file containing list of intervals [] -i intervals [] -? displays help
Paste
Pastes VCF files like the unix paste functions.
Input requirements and assumptions: 1. Same variants are represented in the same order for each file (required) 2. Genotype field order are the same for corresponding records (required) 3. Sample names are different in all the files (warning will be given if not) 4. Headers are the same for all the files (assumption, not checked, will fail if output is BCF) Outputs: 1. INFO fields output will be that of the first file 2. Genotype fields are the same for corresponding records
#paste together genotypes from the CEU trio into one file. vt paste NA12878.mills.bcf NA12891.mills.bcf NA12892.mills.bcf -o ceu_trio.bcf
usage : vt paste [options] <in1.vcf>... options : -L file containing list of input VCF files -o output VCF file [-] -p print options and summary [] -? displays help
Concatenate
Concatenate VCF files. Assumes individuals are in the same order and files share the same header.
#concatenate chr1.mills.bcf and chr2.mills.bcf vt cat chr1.mills.bcf chr2.mills.bcf -o mills.bcf
usage : vt cat [options] <in1.vcf>...
options : -s print site information only without genotypes [false] -p print options and summary [] -L file containing list of input VCF files -o output VCF file [-] -I file containing list of intervals [] -i intervals -? displays help
Remove info tags
Removes INFO tags from a VCF file
#removes the INFO tags OLD_VARIANT, ENTROPY, PSCORE and COMP vt rminfo exact.del.bcf -t OLD_VARIANT,ENTROPY,PSCORE,COMP -o rm.bcf
usage : vt rminfo [options] <in.vcf>
options : -o output VCF file [-] -q do not print options and summary [false] -t list of info tags to be removed [] -I file containing list of intervals [] -i intervals [] -? displays help
Validate
Checks the following properties of a VCF file:
- order
- reference sequence consistency
#validates lobstr.bcf vt validate lobstr.bcf
usage : vt validate [options] <in.vcf> options : -q do not print invalid records [false] -I file containing list of intervals [] -i intervals [] -r reference sequence fasta file [] -? displays help
VCF Inspection and Evaluation
Peek
Summarizes the variants in a VCF file
#summarizes the variants found in mills.vcf vt peek mills.vcf
usage : vt peek [options] <in.vcf>
options : -o output VCF file [-] -I file containing list of intervals [] -i intervals [] -r reference sequence fasta file [] -- ignores the rest of the labeled arguments following this flag -h displays help
For a more detailed guide on variant classification.
#This is a sample output of a peek command which summarizes the variants found in a VCF file. stats: no. of samples : 0 no. of chromosomes : 22
========== Micro variants ==========
no. of SNPs : 77228885 2 alleles (ts/tv) : 77011302 (2.11) [52287790/24723512] 3 alleles (ts/tv) : 216560 (0.75) [185520/247600] 4 alleles (ts/tv) : 1023 (0.50) [1023/2046]
no. of MNPs : 0 2 alleles (ts/tv) : 0 (-nan) [0/0] >=3 alleles (ts/tv) : 0 (-nan) [0/0]
no. Indels : 2147564 2 alleles (ins/del) : 2124842 (0.47) [683250/1441592] >=3 alleles (ins/del) : 22722 (2.12) [32411/15286]
no. SNP/MNP : 0 3 alleles (ts/tv) : 0 (-nan) [0/0] >=4 alleles (ts/tv) : 0 (-nan) [0/0]
no. SNP/Indels : 12913 2 alleles (ts/tv) (ins/del) : 412 (0.41) [120/292] (3.68) [324/88] >=3 alleles (ts/tv) (ins/del) : 12501 (0.43) [7670/17649] (18.64) [12434/667]
no. MNP/Indels : 153 2 alleles (ts/tv) (ins/del) : 0 (-nan) [0/0] (-nan) [0/0] >=3 alleles (ts/tv) (ins/del) : 153 (0.30) [138/465] (0.27) [67/248]
no. SNP/MNP/Indels : 2 3 alleles (ts/tv) (ins/del) : 0 (-nan) [0/0] (-nan) [0/0] 4 alleles (ts/tv) (ins/del) : 2 (0.00) [3/5] (1.00) [3/3] >=5 alleles (ts/tv) (ins/del) : 0 (-nan) [0/0] (-nan) [0/0]
no. of clumped variants : 19025 2 alleles : 0 (-nan) [0/0] (-nan) [0/0] 3 alleles : 18508 (0.16) [12152/75366] (0.00) [93/18653] 4 alleles : 451 (0.15) [369/2390] (0.33) [201/609] >=5 alleles : 66 (0.09) [37/414] (1.19) [107/90]
====== Other useful categories =====
no. complex variants : 32093 2 alleles (ts/tv) (ins/del) : 412 (0.41) [120/292] (3.68) [324/88] >=3 alleles (ts/tv) (ins/del) : 31681 (0.21) [20369/96289] (0.64) [12905/20270]
======= Structural variants ========
no. of structural variants : 41217 2 alleles : 38079 deletion : 13135 insertion : 16451 mobile element : 16253 ALU : 12513 LINE1 : 2911 SVA : 829 numt : 198 duplication : 664 inversion : 100 copy number variation : 7729 >=3 alleles : 3138 copy number variation : 3138
========= General summary ==========
no. of reference : 0
no. of observed variants : 79449759 no. of unclassified variants : 0
Partition
Partition variants from two data sets.
Please note that this only works if the contigs in the headers of both data sets are the same.
#partitions all variants in bi1.bcf and bi2.bcf vt partition bi1.bcf bi2.bcf
Options: input VCF file a bi1.bcf input VCF file b bi2.bcf
A: 504676 variants B: 1389333 variants
ts/tv ins/del A-B 37564 [0.19] [1.34] A&B 467112 [1.55] [0.72] B-A 922221 [1.20] [0.58] of A 92.6% of B 33.6%
#partitions only passed variants in bi1.bcf and bi2.bcf vt partition bi1.bcf bi2.bcf -f PASS
Options: input VCF file a bi1.bcf input VCF file b bi2.bcf [f] filter PASS
A: 466148 variants B: 986056 variants
ts/tv ins/del A-B 47261 [0.44] [1.36] A&B 418887 [1.80] [0.68] B-A 567169 [1.43] [0.72] of A 89.9% of B 42.5%
partition v0.5
description : partition variants. check the overlap of variants between 2 data sets.
usage : vt partition [options] <in1.vcf><in2.vcf>
options : -w write partitioned variants to file -f filter -I file containing list of intervals [] -i intervals [] -? displays help
Multi Partition
Partitions variants found in VCF files.
In comparison to the simple 2 way partition, this does not support writing out of partitions to file and
reporting proportion of shared variants for each VCF.
#partitions variants n-ways vt multi_partition hc.genotypes.bcf pl.genotypes.bcf st.genotypes.bcf
Options: input VCF file a hc.genotypes.bcf input VCF file b pl.genotypes.bcf input VCF file c st.genotypes.bcf
A: 97274 variants B: 95458 variants C: 98943 variants
no [ts/tv] [ins/del] A-- 3887 [1.10] [0.86] -B- 7890 [1.45] [0.98] AB- 4360 [0.99] [1.32] --C 8277 [1.75] [2.21] A-C 7458 [1.78] [0.49] -BC 1639 [1.63] [1.03] ABC 81569 [2.28] [1.08]
Unique variants : 115080 Overall concordance : 70.88% (#intersection/#union)
usage : vt multi_partition [options] <in1.vcf><in2.vcf>... options : -f filter -I file containing list of intervals [] -i intervals [] -? displays help
Annotate Regions
Annotates regions in a VCF file. The BED file should be bgzipped and indexed with tabix.
#annotates the variants that overlap with coding regions. vt annotate_regions mills.vcf -b coding.bed.gz -t CDS -d "Coding region"
#annotates the variants that overlap with low complexity regions. vt annotate_regions mills.vcf -b mdust.bed.gz -t DUST -d "DUST Low Complexity Region"
usage : vt annotate_regions [options] <in.vcf>
options : -d regions tag description [] -t regions tag [] -b regions BED file [] -o output VCF file [-] -I file containing list of intervals [] -i intervals -? displays help
Annotate Variants
Annotates variants in a VCF file. The GENCODE annotation file should be bgzipped and indexed with tabix. This is available in the vt resource bundle.
#annotates the variants found in mills.vcf vt annotate_variants mills.vcf -r hs37d5.fa -g gencode.v19.annotation.gtf.gz
#annotates variants with the following fields ##INFO=<ID=VT,Number=1,Type=String,Description="Variant Type - SNP, MNP, INDEL, CLUMPED"> ##INFO=<ID=GENCODE_FS,Number=0,Type=Flag,Description="Frameshift INDEL"> ##INFO=<ID=GENCODE_NFS,Number=0,Type=Flag,Description="Non Frameshift INDEL">
usage : vt annotate_variants [options] <in.vcf>
options : -g GENCODE annotations GTF file [] -r reference sequence fasta file [] -o output VCF file [-] -I file containing list of intervals [] -i intervals -? displays help
Compute Features
Compute features in a VCF file. Example of statistics are Allele counts, Genotype Likelihood based Inbreeding Coefficient. Hardy-Weinberg Genotype Likelihood based Allele Frequencies
#compute features for the variants found in vt.vcf #requires GT, PL and DP vt compute_features vt.vcf
#annotates variants with the following fields ##INFO=<ID=AC,Number=A,Type=Integer,Description="Alternate Allele Counts"> ##INFO=<ID=AN,Number=1,Type=Integer,Description="Total Number Allele Counts"> ##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data"> ##INFO=<ID=AF,Number=A,Type=Float,Description="Alternate Allele Frequency"> ##INFO=<ID=GC,Number=G,Type=Integer,Description="Genotype Counts"> ##INFO=<ID=GN,Number=1,Type=Integer,Description="Total Number of Genotypes Counts"> ##INFO=<ID=GF,Number=G,Type=Float,Description="Genotype Frequency"> ##INFO=<ID=HWEAF,Number=A,Type=Float,Description="Genotype likelihood based MLE Allele Frequency assuming HWE"> ##INFO=<ID=HWEGF,Number=G,Type=Float,Description="Genotype likelihood based MLE Genotype Frequency assuming HWE"> ##INFO=<ID=MLEAF,Number=A,Type=Float,Description="Genotype likelihood based MLE Allele Frequency"> ##INFO=<ID=MLEGF,Number=G,Type=Float,Description="Genotype likelihood based MLE Genotype Frequency"> ##INFO=<ID=HWE_LLR,Number=1,Type=Float,Description="Genotype likelihood based Hardy Weinberg ln(Likelihood Ratio)"> ##INFO=<ID=HWE_LPVAL,Number=1,Type=Float,Description="Genotype likelihood based Hardy Weinberg Likelihood Ratio Test Statistic ln(p-value)"> ##INFO=<ID=HWE_DF,Number=1,Type=Integer,Description="Degrees of freedom for Genotype likelihood based Hardy Weinberg Likelihood Ratio Test Statistic"> ##INFO=<ID=FIC,Number=1,Type=Float,Description="Genotype likelihood based Inbreeding Coefficient"> ##INFO=<ID=AB,Number=1,Type=Float,Description="Genotype likelihood based Allele Balance">
usage : vt compute_features for variants [options] <in.vcf> options : -s print site information only without genotypes [false] -o output VCF/VCF.GZ/BCF file [-] -f filter expression [] -I File containing list of intervals -i Intervals -? displays help
Estimate
Compute variant based estimates.
Example of statistics are: * Allele counts * Hardy-Weinberg Genotype Likelihood based Allele Frequencies * Genotype Likelihood based Inbreeding Coefficient * Genotype Likelihood based Hardy-Weinberg test * Genotype Likelihood based Allele Balance
#compute features for the variants found in vt.vcf #requires GT and PL vt estimate -e AF,MLEAF vt.vcf
AF Genotype (GT) based allele frequencies If genotypes are unavailable, best guess genotypes are inferred based on genotype likelihoods (GL or PL) AC : Alternate Allele counts AN : Total allele counts NS : No. of samples. AF : Alternate allele frequencies. MLEAF GL based allele frequencies estimates MLEAF : Alternate allele frequency derived from MLEGF MLEGF : Genotype frequencies. HWEAF GL based allele frequencies estimates assuming HWE HWEAF : Alternate allele frequencies HWEGF : Genotype frequencies derived from HWEAF. HWE GL based Hardy-Weinberg statistics. HWE_LLR : log likelihood ratio HWE_LPVAL : log p-value HWE_DF : degrees of freedom AB GL based Allele Balance. FIC GL based Inbreeding Coefficient
usage : vt estimate [options] <in.vcf> options : -s print site information only without genotypes [false] -o output VCF/VCF.GZ/BCF file [-] -e comma separated estimates to be computed [] -f filter expression [] -I File containing list of intervals -i Intervals -? displays help
Profile SNPs
Profile SNPs. The reference data sets can be obtained from vt resource bundle.
#profile snps found in 20.sites.vcf vt profile_snps -g snp.reference.txt 20.sites.vcf -r hs37d5.fa -i 20
#this is a sample output for indel profiling. # square brackets contain the ts/tv ratio. # The numbers in curved bracket are the counts of ts and tv SNPs respectively. # Low complexity shows what percent of the SNPs are in low complexity regions. data set No. SNPs : 508603 [2.09] Low complexity : 0.08 (39837/508603)
1000g A-B 109970 [1.39] A&B 398633 [2.37] B-A 1340682 [2.26] Precision 78.4% Sensitivity 22.9%
dbsnp A-B 324063 [1.99] A&B 184540 [2.29] B-A 103893 [2.60] Precision 36.3% Sensitivity 64.0%
# This file contains information on how to process reference data sets. # # dataset - name of data set, this label will be printed. # type - True Positives (TP) and False Positives (FP) # overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively # - annotation # file is used for GENCODE annotation of frame shift and non frame shift Indels # filter - filter applied to variants for this particular data set # path - path of indexed BCF file #dataset type filter path 1000g TP N_ALLELE==2&&VTYPE==SNP /net/fantasia/home/atks/ref/vt/grch37/1000G.v5.snps.indels.complex.svs.sites.bcf dbsnp TP N_ALLELE==2&&VTYPE==SNP /net/fantasia/home/atks/ref/vt/grch37/dbSNP138.snps.indels.complex.sites.bcf GENCODE_V19 cds_annotation . /net/fantasia/home/atks/ref/vt/grch37/gencode.v19.cds.bed.gz DUST cplx_annotation . /net/fantasia/home/atks/ref/vt/grch37/mdust.bed.gz
usage : vt profile_snps [options] <in.vcf>
options : -f filter expression [] -g file containing list of reference datasets [] -I file containing list of intervals [] -i intervals [] -r reference sequence fasta file [] -? displays help
Profile Indels
Profile Indels. The reference data sets can be obtained from vt resource bundle.
#profile indels found in mills.vcf vt profile_indels -g indel.reference.txt mills.vcf -r hs37d5.fa -i 20
#this is a sample output for indel profiling. # square brackets contain the ins/del ratio. # for the FS/NFS field, that is the proportion of coding indels that are frame shifted. # The numbers in curved bracket are the counts of frame shift and non frame shift indels respectively. data set No Indels : 46974 [0.89] FS/NFS : 0.26 (8/23)
dbsnp A-B 30704 [0.92] A&B 16270 [0.83] B-A 2049488 [1.52] Precision 34.6% Sensitivity 0.8%
mills A-B 43234 [0.88] A&B 3740 [1.00] B-A 203278 [0.98] Precision 8.0% Sensitivity 1.8%
mills.chip A-B 46847 [0.89] A&B 127 [0.90] B-A 8777 [0.93] Precision 0.3% Sensitivity 1.4%
affy.exome.chip A-B 46911 [0.89] A&B 63 [0.43] B-A 33997 [0.47] Precision 0.1% Sensitivity 0.2%
# This file contains information on how to process reference data sets. # dataset - name of data set, this label will be printed. # type - True Positives (TP) and False Positives (FP). # overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively. # - annotation. # file is used for GENCODE annotation of frame shift and non frame shift Indels. # filter - filter applied to variants for this particular data set. # path - path of indexed BCF file. #dataset type filter path 1000g TP N_ALLELE==2&&VTYPE==INDEL /net/fantasia/home/atks/ref/vt/grch37/1000G.snps_indels.sites.bcf mills TP N_ALLELE==2&&VTYPE==INDEL /net/fantasia/home/atks/ref/vt/grch37/mills.208620indels.sites.bcf dbsnp TP N_ALLELE==2&&VTYPE==INDEL /net/fantasia/home/atks/ref/vt/grch37/dbsnp.13147541variants.sites.bcf GENCODE_V19 cds_annotation . /net/fantasia/home/atks/ref/vt/grch37/gencode.cds.bed.gz DUST cplx_annotation . /net/fantasia/home/atks/ref/vt/grch37/mdust.bed.gz
usage : vt profile_indels [options] <in.vcf>
options : -g file containing list of reference datasets [] -I file containing list of intervals [] -i intervals [] -r reference sequence fasta file [] -? displays help
Profile Mendelian Errors
Profile Mendelian errors
#profile mendelian errors found in vt.genotypes.bcf, generate tables in the directory mendel, requires pdflatex. vt profile_mendelian vt.genotypes.bcf -p trios.ped -x mendel
#this is a sample output for mendelian error profiling. #R and A stand for reference and alternate allele respectively. #Error% - mendelian error (confounded with de novo mutation) #HomHet - Homozygous-Heterozygous genotype ratios #Het% - proportion of hets Mendelian Errors
Father Mother R/R R/A A/A Error(%) HomHet Het(%) R/R R/R 14889 210 38 1.64 nan nan R/R R/A 3403 3497 74 1.06 0.97 50.68 R/R A/A 176 1482 155 18.26 nan nan R/A R/R 3665 3652 68 0.92 1.00 49.91 R/A R/A 1015 3151 990 0.00 0.64 61.11 R/A A/A 43 1300 1401 1.57 1.08 48.13 A/A R/R 172 1365 147 18.94 nan nan A/A R/A 47 1164 1183 1.96 1.02 49.60 A/A A/A 20 78 5637 1.71 nan nan
Parental R/R R/A A/A Error(%) HomHet Het(%) R/R R/R 14889 210 38 1.64 nan nan R/R R/A 7068 7149 142 0.99 0.99 50.28 R/R A/A 348 2847 302 18.59 nan nan R/A R/A 1015 3151 990 0.00 0.64 61.11 R/A A/A 90 2464 2584 1.75 1.05 48.81 A/A A/A 20 78 5637 1.71 nan nan
Parental R/R R/A A/A Error(%) HomHet Het(%) HOM HOM 14909 288 5675 1.66 nan nan HOM HET 7158 9613 2726 1.19 1.00 49.90 HET HET 1015 3151 990 0.00 0.64 61.11 HOMREF HOMALT 348 2847 302 18.59 nan nan
total mendelian error : 2.505% no. of trios : 2 no. of variants : 25346
profile_mendelian v0.5
usage : vt profile_mendelian [options] <in.vcf>
options : -q minimum genotype quality -d minimum depth -r reference sequence fasta file [] -x output latex directory [] -p pedigree file -I file containing list of intervals [] -i intervals -? displays help
Profile NA12878
Profile Mendelian errors
#profile NA12878 overlap with broad knowledgebase and illumina platinum genomes for the file vt.genotypes.bcf for chromosome 20. vt profile_na12878 vt.genotypes.bcf -g na12878.reference.txt -r hs37d5.fa -i 20
#this is a sample output for mendelian error profiling. #R and A stand for reference and alternate allele respectively. #Error% - mendelian error (confounded with de novo mutation) #HomHet - Homozygous-Heterozygous genotype ratios #Het% - proportion of hets data set No Indels : 27770 [0.94] FS/NFS : 0.26 (8/23)
broad.kb A-B 13071 [1.19] A&B 14699 [0.76] B-A 21546 [0.62] Precision 52.9% Sensitivity 40.6%
illumina.platinum A-B 17952 [0.88] A&B 9818 [1.07] B-A 2418 [0.88] Precision 35.4% Sensitivity 80.2%
broad.kb R/R R/A A/A ./. R/R 346 145 3 5473 R/A 3 4133 9 758 A/A 2 136 2186 956 ./. 2 139 86 322
Total genotype pairs : 6963 Concordance : 95.72% (6665) Discordance : 4.28% (298)
illumina.platinum R/R R/A A/A ./. R/R 1768 85 2 0 R/A 10 4479 14 0 A/A 13 180 3028 0 ./. 71 98 70 0
Total genotype pairs : 9579 Concordance : 96.83% (9275) Discordance : 3.17% (304)
# This file contains information on how to process reference data sets. # # dataset - name of data set, this label will be printed. # type - True Positives (TP) and False Positives (FP) # overlap percentages labeled as (Precision, Sensitivity) and (False Discovery Rate, Type I Error) respectively # - annotation # file is used for GENCODE annotation of frame shift and non frame shift Indels # filter - filter applied to variants for this particular data set # path - path of indexed BCF file #dataset type filter path broad.kb TP PASS /net/fantasia/home/atks/dev/vt/bundle/public/grch37/broad.kb.241365variants.genotypes.bcf illumina.platinum TP PASS /net/fantasia/home/atks/dev/vt/bundle/public/grch37/NA12878.illumina.platinum.5284448variants.genotypes.bcf #gencode.v19 annotation . /net/fantasia/home/atks/dev/vt/bundle/public/grch37/gencode.v19.annotation.gtf.gz
profile_na12878 v0.5
usage : vt profile_na12878 [options] <in.vcf>
options : -g file containing list of reference datasets [] -I file containing list of intervals [] -i intervals [] -r reference sequence fasta file [] -? displays help
Variant Calling
Discover
Discovers variants from reads in a BAM file.
#discover variants from NA12878.bam and write to stdout vt discover -b NA12878.bam -s NA12878 -r hs37d5.fa -i 20 -v snps,indels,mnps
usage : vt discover [options]
options : -b input BAM file -v variant types [snps,mnps,indels] -f fractional evidence cutoff for candidate allele [0.1] -e evidence count cutoff for candidate allele [2] -q base quality cutoff for bases [13] -m MAPQ cutoff for alignments [20] -s sample ID -r reference sequence fasta file [] -o output VCF file [-] -I file containing list of intervals [] -i intervals [] -- ignores the rest of the labeled arguments following this flag -h displays help
Discover2
Discovers variants from reads in a BAM/CRAM file.
#discover variants from NA12878.bam and write to stdout vt discover2 -b NA12878.bam -s NA12878 -r hs37d5.fa -i 20 -v snps,indels,mnps
usage : vt discover2 [options]
options : -b input BAM/CRAM file -y soft clipped unique sequences cutoff [0] -x soft clipped mean quality cutoff [0] -w insertion desired type II error [0.0] -c insertion desired type I error [0.0] -h insertion fractional evidence cutoff [0] -g insertion count cutoff [1] -n deletion desired type II error [0.0] -m deletion desired type I error [0.0] -v deletion fractional evidence cutoff [0] -u deletion count cutoff [1] -k snp desired type II error [0.0] -j snp desired type I error [0.0] -f snp fractional evidence cutoff [0] -e snp evidence count cutoff [1] -q base quality cutoff for bases [0] -C likelihood ratio cutoff [0] -B reference bias [0] -a read exclude flag [0x0704] -l ignore overlapping reads [false] -t MAPQ cutoff for alignments [0] -p ploidy [2] -s sample ID -r reference sequence fasta file [] -o output VCF file [-] -z ignore MD tags [0] -d debug [0] -I file containing list of intervals [] -i intervals [] -? displays help
Merge candidate variants
Merge candidate variants across samples. Each VCF file is required to have the FORMAT flags E and N and should have exactly one sample.
#merge candidate variants from VCFs in candidate.txt and output in candidate.sites.vcf vt merge_candidate_variants candidates.txt -o candidate.sites.vcf
usage : vt merge_candidate_variants [options]
options : -L file containing list of input VCF files -o output VCF file [-] -I file containing list of intervals [] -i intervals -- ignores the rest of the labeled arguments following this flag -h displays help
Annotate Indels
Annotates indels with VNTR information and adds a VNTR record. Facilitates the simultaneous calling of VNTR together with Indels and SNPs.
#annotates indels from VCFs with VNTR information. vt annotate_indels in.vcf -r hs37d5.fa -o annotated.sites.vcf
20 82079 . G A 1255.98 . NSAMPLES=1;E=43;N=51;ESUM=43;NSUM=51;FLANKSEQ=GGAGCACGCC[G/A]CCATGCCCGG 20 82217 . G A 1632.77 . NSAMPLES=1;E=56;N=61;ESUM=56;NSUM=61;FLANKSEQ=GAGCCACCGC[G/A]CCCGGCCCAG 20 83250 . CTGTGTGTG C . . NSAMPLES=1;E=18;N=35;ESUM=18;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:<VNTR>:GT 20 83250 . CTGTGTGTGTG C . . NSAMPLES=1;E=3;N=35;ESUM=3;NSUM=35;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT]TTAGTATTTG;GMOTIF=GT;TR=20:83251:TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG:<VNTR>:GT 20 83251 . TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG <VNTR> . . MOTIF=GT;RU=TG;FZ_CONCORDANCE=1;FZ_RL=52;FZ_LL=0;FLANKS=83250,83304;FZ_FLANKS=83250,83303;FZ_RU_COUNTS=26,26;FLANKSEQ=TCTCTCTCTC[TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG]TTTAGTATTT 20 83252 . G C 359.204 . NSAMPLES=1;E=13;N=14;ESUM=13;NSUM=14;FLANKSEQ=CTCTCTCTCT[G/C]TGTGTGTGTG 20 83260 . G C 500.163 . NSAMPLES=1;E=18;N=34;ESUM=18;NSUM=34;FLANKSEQ=CTGTGTGTGT[G/C]TGTGTGTGTG 20 83267 . T C 247.043 . NSAMPLES=1;E=11;N=43;ESUM=11;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT 20 83275 . T C 609.669 . NSAMPLES=1;E=24;N=43;ESUM=24;NSUM=43;FLANKSEQ=TGTGTGTGTG[T/C]GTGTGTGTGT 20 90008 . C A 1546.88 . NSAMPLES=1;E=52;N=60;ESUM=52;NSUM=60;FLANKSEQ=AACAGAAAAC[C/A]AAATACTGTA 20 91088 . C T 1766.04 . NSAMPLES=1;E=58;N=66;ESUM=58;NSUM=66;FLANKSEQ=CCCAGCATAC[C/T]ATGGTTGTGC 20 91508 . G A 1266.93 . NSAMPLES=1;E=44;N=53;ESUM=44;NSUM=53;FLANKSEQ=AATTAGTAAG[G/A]CTTACGTAAG 20 91707 . C T 888.134 . NSAMPLES=1;E=30;N=53;ESUM=30;NSUM=53;FLANKSEQ=TGATTTTCTA[C/T]AGCAGGACCT 20 92527 . A G 828.593 . NSAMPLES=1;E=34;N=40;ESUM=34;NSUM=40;FLANKSEQ=ATTAATTGCC[A/G]TTCTCTCTTT 20 93440 . A G 688.144 . NSAMPLES=1;E=24;N=58;ESUM=24;NSUM=58;FLANKSEQ=TTGGATGCAT[A/G]GTCTGTAAAT 20 93636 . TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT <VNTR> . . MOTIF=T;RU=T;FZ_CONCORDANCE=0.939394;FZ_RL=35;FZ_LL=0;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FZ_RU_COUNTS=31,33;FLANKSEQ=TCTAGGATTC[TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT 20 93646 . C CT . . NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKS=93646,93671;FZ_FLANKS=93635,93671;FLANKSEQ=TTTTTCTTTC[TTTTTTTTTTTTTTTTTTTTTTTT]GAGATGGAGT;GMOTIF=T;TR=20:93636:TTTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT:<VNTR>:T 20 93717 . A T 31.7622 . NSAMPLES=1;E=2;N=29;ESUM=2;NSUM=29;FLANKSEQ=CAGTGGCGTG[A/T]TCTTAGATCA 20 93931 . G A 628.149 . NSAMPLES=1;E=22;N=53;ESUM=22;NSUM=53;FLANKSEQ=GATTACAGGT[G/A]TGAGCCGCTG 20 100699 . C T 809.09 . NSAMPLES=1;E=28;N=61;ESUM=28;NSUM=61;FLANKSEQ=GGTGAAAAAT[C/T]ACCTGTCAGT 20 101362 . G A 1087.13 . NSAMPLES=1;E=36;N=67;ESUM=36;NSUM=67;FLANKSEQ=TAATACTGAA[G/A]TTTACTTCTC
The following shows the trace of how the algorithm works
============================================ ANNOTATING INDEL FUZZILY ******************************************** EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT 20:131948:C/CCA EXACT REGION 131948-131965 (18) CCACACACACACACACAA FINAL EXACT REGION 131948-131965 (18) CCACACACACACACACAA ******************************************** PICK CANDIDATE MOTIFS Longest Allele : C[CA]CACACACACACACACAA detecting motifs for an str seq: CCACACACACACACACACAA len : 20 cmax_len : 10 candidate motifs: 25 AC : 0.894737 2 0 AAC : 0.5 3 0.0555556 ACC : 0.5 3 0.0555556 AAAC : 0.0588235 4 0.125 (< 2 copies) ACCC : 0.0588235 4 0.125 (< 2 copies) AACAC : 0.5 5 0.02 ACACC : 0.5 5 0.02 AAACAC : 0.0666667 6 0.0555556 (< 2 copies) ACACCC : 0.0666667 6 0.0555556 (< 2 copies) AACACAC : 0.5 7 0.0102041 ACACACC : 0.5 7 0.0102041 AAACACAC : 0.0769231 8 0.03125 (< 2 copies) ACACACCC : 0.0769231 8 0.03125 (< 2 copies) AACACACAC : 0.5 9 0.00617284 (< 2 copies) ACACACACC : 0.5 9 0.00617284 (< 2 copies) AAACACACAC : 0.0909091 10 0.02 (< 2 copies) ACACACACCC : 0.0909091 10 0.02 (< 2 copies) ******************************************** PICKING NEXT BEST MOTIF selected: AC 0.89 0.00 selected: AC 0.89 0.00 ******************************************** 4. DETECTING REPEAT TRACT FUZZILY ++++++++++++++++++++++++++++++++++++++++++++ 4a. Exact left/right alignment repeat_tract : CACACACACACACACA position : [131949,131964] motif_concordance : 1 repeat units : 8 exact repeat units : 8 total no. of repeat units : 8 ++++++++++++++++++++++++++++++++++++++++++++ 4a. Fuzzy right alignment 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)Atks (talk) 17:00, 5 October 2015 (EDT) repeat motif : CA rflank : AACTC mlen : 2 rflen : 5 plen : 111 read : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC rlen : 106 optimal score: 50.5073 optimal state: MR optimal track: MR|r|0|5 optimal probe len: 25 optimal path length : 107 max j: 106 probe: (1~82) [1~10] (1~5) read : (1~82) [83~101] (102~106) motif # : 10 [83,101] motif concordance : 0.95% (9/10) motif discordance : 0|1|0|0|0|0|0|0|0|0 Model: ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME oo++oo++oo++oo++oo++RRRRR Read: AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)Atks (talk) 17:00, 5 October 2015 (EDT) ++++++++++++++++++++++++++++++++++++++++++++ 4b. Fuzzy left alignment 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)Atks (talk) 17:00, 5 October 2015 (EDT) QUAL+33 MATCH MISMATCH PENALTY 42 2.10001 -5.10001 -2.10001 lflank : ATCTTA repeat motif : CA lflen : 6 mlen : 2 plen : 111 read : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT rlen : 105 optimal score: 50.5858 optimal state: Z optimal track: Z|m|10|2 optimal probe len: 26 optimal path length : 106 max j: 105 mismatch penalty: 3 model: (1~6) [1~10] read : (1~6) [7~25][26~106] motif # : 10 [7,25] motif concordance : 0.95% (9/10) motif discordance : 0|1|0|0|0|0|0|0|0|0 Model: ATCTTACACACACACACACACACACA-------------------------------------------------------------------------------- SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE LLLLLLoo++oo++oo++oo++oo++ Read: ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT 17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)17:00, 5 October 2015 (EDT)Atks (talk) 17:00, 5 October 2015 (EDT) xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx VNTR Summary rid : 19 motif : AC ru : CA Exact repeat_tract : CACACACACACACACA position : [131949,131964] reference repeat unit length : 8 longest allele length : 4.55884e-41 motif_concordance : 1 repeat units : 8 exact repeat units : 8 total no. of repeat units : 8 Fuzzy repeat_tract : CACCACACACACACACACA position : [131946,131964] reference repeat unit length : 19 longest allele length : 0 motif_concordance : 0.95 repeat units : 19 exact repeat units : 9 total no. of repeat units : 10 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
usage : vt annotate_indels [options] <in.vcf>
options : -v add vntr record [false] -x override tags [false] -f filter expression [] -d debug [false] -m mode [f] e : by exact alignment f : by fuzzy alignment -c classification schemas of tandem repeat [6] 1 : lai2003 2 : kelkar2008 3 : fondon2012 4 : ananda2013 5 : willems2014 6 : tan_kang2015 -a annotation type [v] v : a. output VNTR variant (defined by classification). RU repeat unit on reference sequence (CA) MOTIF canonical representation (AC) RL repeat tract length in bases (11) FLANKS flanking positions of repeat tract determined by exact alignment RU_COUNTS number of exact repeat units and total number of repeat units in repeat tract determined by exact alignment FZ_RL fuzzy repeat tract length in bases (11) FZ_FLANKS flanking positions of repeat tract determined by fuzzy alignment FZ_RU_COUNTS number of exact repeat units and total number of repeat units in repeat tract determined by fuzzy alignment FLANKSEQ flanking sequence of indel LARGE_REPEAT_REGION repeat region exceeding 2000bp b. mark indels with overlapping VNTR. FLANKS flanking positions of repeat tract determined by exact alignment FZ_FLANKS flanking positions of repeat tract determined by fuzzy alignment GMOTIF generating motif used in fuzzy alignment TR position and alleles of VNTR (20:23413:CACACACACAC:<VNTR>) a : annotate each indel with RU, RL, MOTIF, REF. -r reference sequence fasta file [] -o output VCF file [-] -I file containing list of intervals [] -i intervals -? displays help
Construct Probes
Construct probes for genotyping a variant.
#construct probes from candidate.sites.bcf and output to standard out vt construct_probes candidates.sites.bcf -r ref.fa
usage : vt construct_probes [options] <in.vcf>
options : -o output VCF file [-] -f minimum flank length [20] -r reference sequence fasta file [] -I file containing list of intervals [] -i intervals [] -- ignores the rest of the labeled arguments following this flag -h displays help
Genotype
Genotypes variants for each sample.
#genotypes variants found in candidate.sites.vcf from sample.bam vt genotype -r seq.fa -b sample.bam -i candidates.sites.vcf -o sample.sites.vcf
usage : vt genotype [options]
options : -r reference sequence fasta file [] -s sample ID [] -o output VCF file [-] -b input BAM file [] -i input candidate VCF file [] -- ignores the rest of the labeled arguments following this flag -h displays help
Resource Bundle
- External : resource bundle
- Internal : /net/fantasia/home/atks/ref/vt/grch37
FAQ
1. vt cannot retrieve sequences from my reference sequence file
It is common to use reference files based on the UCSC browser's database and from the Genome Reference Consortium. For example, HG19 vs Grch37. The key difference is that chromosome 1 is represented as chr1 and 1 respectively in the FASTA files from these 2 sources. Just use the appropriate FASTA file that was used to generate your VCF file originally.
Another common issue is due to the corruption of the index file of the reference sequence; say for a reference file named hs37d5.fa or hs37d5.fa.gz, simply delete the index file denoted by hs37d5.fa.fai or hs37d5.fa.gz.fai and run the vt command again. A new index file will be generated automatically.
Maintained by
This page is maintained by Adrian