Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

14,242 bytes added, 20:44, 25 February 2016
Representation of close by variants
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.
On this wiki page, we describe a a variant classification system for VCF variantsentries that is invariant to [http://genome.sph.umich.edu/wiki/Variant_Normalization normalization] except for the case of MNPs.
= Definitions =
The normalization definition of a variant representation in VCF consists is based on the definition of two parts: parsimony and left alignment pertaining each allele with respect to the nature of a variant's length and position respectivelyreference sequence. We consider 5 major types loosely decribed as follows.
;1. SNP
: The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
;2. MNP
: The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
: OR
: All reference and alternate sequences have the same length (this is applicable to all alleles).
;3. INDEL
: The reference and alternate sequences are not of the same length.
;4. CLUMPED
: A clumping of nearby SNPs, MNPs or Indels.
;5. SV
: The alternate sequence is represented by an angled bracket tag.
= Classification Procedure =
 
#Trim each allele with respect to the reference sequence individually
#Inspect length, defined as length of alternate allele minus length of reference allele.
##if length = 0
###if length(ref) = 1 and nucleotides differ, classify as SNP (count ts and tv too)
###if length(ref) > 1
####if all nucleotides differ, classify as MNP (count ts and tv too)
####if not all nucleotides differ, classify as CLUMPED (count ts and tv too)
##if length <math>\ne</math> 0, classify as INDEL
###if shorter allele is of length 1
####if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification
###if shorter allele length > 1
####compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)
#####if all nucleotides differ, add MNP classification
#####if not all nucleotides differ, add CLUMPED classification
#Variant classification is the union of the classifications of each allele present in the variant.
#If all alleles are the same length, add MNP classification.
 
= Examples =
 
We present the following examples to explain the classification described.
 
== Legend for examples ==
 
&lt;variant classification&gt;<br>
REF &lt;reference sequence&gt;
ALT &lt;alternative sequence 1&gt; #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt;
ALT &lt;alternative sequence 2&gt; #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt;
 
== Simple Biallelic Examples ==
 
SNP<br>
REF A
ALT G #SNP, 1 ts
 
MNP<br>
REF AT
ALT GC #MNP, 2 ts
 
INDEL<br>
REF AT
ALT A #INDEL, 1 del
 
INDEL<br>
REF AT
ALT T #INDEL, 1 del
#Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base.
#If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles.
#Simple Indel classification should be invariant whether it is left or right aligned.
 
SV<br>
REF A
ALT &lt;DEL&gt; #SV
 
== Complex Biallelic Examples ==
 
SNP|INDEL<br>
REF AT
ALT G #SNP, INDEL, 1 ts
#Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually
#not defined. In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which
#is a transversion. In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition
#and transversion contribution. But please be very clear that this is an ambiguous case. It is better to consider this simply
#as a complex variant.
 
MNP|INDEL<br>
REF ATT
ALT GG #MNP, INDEL, 1 ts, 1 tv, 1 del
 
MNP|CLUMPED<br>
REF ATTTT
ALT GTTTC #MNP, CLUMPED, 2 ts
#since all the alleles are of the same length, classified as MNP too.
 
INDEL|CLUMPED<br>
REF ATTTTTTTT
ALT GTTTC #INDEL, CLUMPED, 2 ts, 1 del
 
== Simple Multiallelic Examples ==
 
SNP<br>
REF A
ALT G #SNP, 1 ts
ALT C #SNP, 1 tv
 
MNP<br>
REF AG
ALT GC #MNP, 1 ts, 1 tv
ALT CT #MNP, 2 tv
 
INDEL<br>
REF ATTT
ALT ATT #INDEL, 1 del
ALT ATTTT #INDEL, 1 ins
 
== Complex Multiallelic Examples ==
 
SNP|MNP<br>
REF AT
ALT GT #SNP, 1 ts
ALT AC #SNP, 1 ts
#since all the alleles are of the sample length, classified as MNP too.
 
SNP|MNP|CLUMPED<br>
REF ATTTG
ALT GTTTC #CLUMPED, 1 ts, 1 tv
ALT ATTTC #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP
#since all the alleles are of the sample length, classified as MNP too.
 
SNP|MNP|INDEL<br>
REF GT
ALT CT #SNP, 1 tv
ALT AG #MNP, 2 tv
ALT GTT #INDEL, 1 ins
 
SNP|MNP|INDEL|CLUMPED<br>
REF GTTT
ALT CG #MNP, INDEL, 2 tv, 1 del
ALT AG #MNP, INDEL, 1 ts, 1 tv
ALT GTGTG #SNP, INDEL, CLUMPED, 1 tv, 1 ins
 
== Structured Variants Examples ==
 
SV<br>
REF G
ALT &lt;INS:ME:LINE1&gt; #SV
SV<br>
REF G
ALT &lt;CN4&gt; #SV
ALT &lt;CN12&gt; #SV
 
=Interesting Variant Types =
 
Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. <br>
 
20 9538655 <span style="color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> <STR>
 
This can be induced as
one record considering only the ATTT repeats
20 9538655 <span style="color:#FF0000">ATTTATTTATTT </span> <span style="color:#FF0000">ATTT </span>
 
one record with CATT repeats
20 9538695 <span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>
 
one record with a mix of both repeat types
20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>
 
= Representation of close by variants =
 
1:124001690
TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG
TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
 
a single complex variant
CHROM POS REF ALT
1 124001690 C AAA
 
an Indel and SNP adjacent to one another
CHROM POS REF ALT
1 124001689 T TAA
1 124001690 C A
 
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together.
Representing it as 2 separate variants allows both alleles to segregate independently.
 
= Output =
 
This is the annotated output of peek in the vt suite.
 
stats:no. of samples : 0 #number of genotype fields in VCF file, this is a site list so it is 0
no. of chromosomes : 25 #no. of chromosomes observed in this file.<br>
========== Micro variants ========== <br>
no. of SNP : 54247827 #total number of SNPs
2 alleles : 53487808 (1.99) [35616038/17871770] #ts/tv ratio and the respective counts
3 alleles : 389190 (0.60) [291224/487156]
4 alleles : 370828 (0.50) [370828/741656]
>=5 alleles : 1 (0.33) [1/3] <br>
no. of MNP : 122125
2 alleles : 121849 (1.56) [152383/97816]
3 alleles : 273 (0.89) [537/601]
4 alleles : 3 (1.00) [9/9] <br>
no. of Indel : 6600770 #also referred to as simple Indels
2 alleles : 6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts
3 alleles : 280892 (8.72) [503977/57807]
4 alleles : 28245 (131.19) [84094/641]
>=5 alleles : 5772 (3847.00) [23082/6] <br>
no. of SNP/MNP : 1161
3 alleles : 1143 (1.57) [1565/994]
4 alleles : 15 (1.36) [34/25]
>=5 alleles : 3 (0.67) [8/12] <br>
no. of SNP/Indel : 115153
2 alleles : 42717 (0.65) [16778/25939] (0.57) [15441/27276] #ts/tv and ins/del ratios
3 alleles : 66401 (0.72) [29681/41397] (0.33) [31458/96168]
4 alleles : 4631 (0.55) [2420/4386] (0.25) [2602/10306]
>=5 alleles : 1404 (0.62) [1197/1926] (0.10) [513/4989] <br>
no. of MNP/Indel : 15619
2 alleles : 12820 (0.51) [12099/23648] (0.77) [5594/7226]
3 alleles : 2455 (0.40) [1796/4469] (0.45) [1144/2546]
4 alleles : 292 (0.24) [215/891] (1.42) [415/292]
>=5 alleles : 52 (0.43) [96/225] (2.47) [126/51] <br>
no. of SNP/MNP/Indel : 273
3 alleles : 167 (0.63) [201/321] (0.38) [70/184]
4 alleles : 85 (0.35) [71/203] (0.28) [31/111]
>=5 alleles : 21 (0.35) [24/68] (0.68) [25/37]<br>
no. of MNP/Clumped : 61175
2 alleles : 60617 (1.68) [84410/50220]
3 alleles : 549 (1.23) [1777/1449]
4 alleles : 8 (1.43) [53/37]
>=5 alleles : 1 (1.00) [5/5] <br>
no. of SNP/MNP/Clumped : 290
3 alleles : 282 (1.35) [665/494]
4 alleles : 8 (0.57) [13/23] <br>
no. of Indel/Clumped : 27638
2 alleles : 25971 (0.65) [31435/48526] (0.79) [11444/14527]
3 alleles : 1585 (0.74) [3568/4793] (0.87) [1383/1582]
4 alleles : 70 (0.55) [96/175] (1.61) [124/77]
>=5 alleles : 12 (0.59) [37/63] (4.71) [33/7] <br>
no. of SNP/Indel/Clumped : 456
3 alleles : 257 (0.84) [332/394] (0.33) [111/340]
4 alleles : 174 (0.38) [105/279] (0.58) [186/321]
>=5 alleles : 25 (0.19) [12/63] (0.94) [44/47] <br>
no. of MNP/Indel/Clumped : 153
3 alleles : 138 (0.50) [233/466] (0.84) [102/122]
4 alleles : 12 (0.35) [14/40] (1.42) [17/12]
>=5 alleles : 3 (0.64) [7/11] (0.67) [4/6] <br>
no. of SNP/MNP/Indel/Clumped : 6
4 alleles : 1 (3.00) [3/1] (0.00) [0/3]
>=5 alleles : 5 (0.62) [8/13] (2.00) [12/6] <br>
no. of Reference : 0 <br>
====== Other useful categories ===== <br>
no. of Block Substitutions : 184751 #equivalent to categories with allele lengths that are the same.
2 alleles : 182466 (1.60) [236793/148036]
3 alleles : 2247 (1.28) [4544/3538]
4 alleles : 34 (1.16) [109/94]
>=5 alleles : 4 (0.76) [13/17] <br>
no. of Complex Substitutions : 159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels
2 alleles : 81508 (0.61) [60312/98113] (0.66) [32479/49029]
3 alleles : 71003 (0.69) [35811/51840] (0.34) [34268/100942]
4 alleles : 5265 (0.49) [2924/5975] (0.30) [3375/11122]
>=5 alleles : 1522 (0.58) [1381/2369] (0.15) [757/5143] <br>
======= Structural variants ========<br>
no. of structural variants : 41217
2 alleles : 38079
deletion : 13135
insertion : 16451
mobile element : 16253
ALU : 12513
LINE1 : 2911
SVA : 829
numt : 198
duplication : 664
inversion : 100
copy number variation : 7729
>=3 alleles : 3138
copy number variation : 3138 <br>
========= General summary ========== <br>
no. of observed variants : 79449759
no. of unclassified variants : 0
 
= Implementation =
 
This is implemented in [http://genome.sph.umich.edu/wiki/Vt#Peek vt].
= Maintained by =
This page is maintained by [mailto:atks@umich.edu Adrian].
1,102
edits

Navigation menu