Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

2,992 bytes added, 20:44, 25 February 2016
Representation of close by variants
The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences.
On this wiki page, we describe a a variant classification system for VCF variantsentries that is invariant to [http://genome.sph.umich.edu/wiki/Variant_Normalization normalization] except for the case of MNPs.
= Definitions =
The definition of a variant is based on the definition of each allele with respect to the reference sequence. We consider 5 major types loosely decribed as follows.
;1. SNP
: The reference and alternate sequences are of length 1 and the base nucleotide is different from one another.
;2. MNP
: a.The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another.
: OR
: b. all All reference and alternate sequences have the same length(this is applicable to all alleles).
;3. INDEL
: a. The reference and alternate sequence sequences are not of the same length.: AND: b. The removal of a subsequence of the longer sequence would reduce the longer sequence to the smaller sequence.
;4. CLUMPED
: A clumping of nearby SNPs, MNPs or Indels.
;5. SV
: The alternate sequence is represented by a an angled bracket tag. = Classification Procedure = #Trim each allele with respect to the reference sequence individually#Inspect length, defined as length of alternate allele minus length of reference allele.##if length = 0###if length(ref) = 1 and nucleotides differ, classify as SNP (count ts and tv too)###if length(ref) > 1 ####if all nucleotides differ, classify as MNP (count ts and tv too)####if not all nucleotides differ, classify as CLUMPED (count ts and tv too)##if length <math>\ne</math> 0, classify as INDEL###if shorter allele is of length 1####if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification ###if shorter allele length > 1####compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too)#####if all nucleotides differ, add MNP classification#####if not all nucleotides differ, add CLUMPED classification#Variant classification is the union of the classifications of each allele present in the variant.#If all alleles are the same length, add MNP classification.
= Examples =
We present the following examples to explain the concepts explained earlierclassification described== Legend for examples ==  &lt;variant classification&gt;<br> REF &lt;reference sequence&gt; ALT &lt;alternative sequence 1&gt; #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt; ALT &lt;alternative sequence 2&gt; #&lt;allele classification&gt;, &lt;contribution to transition, transversion, insertion or deletion count&gt;
== Simple Biallelic Examples ==
SNP<br>
REF A
ALT G #SNP, 1 ts
MNP<br>
REF AT ALT GC #MNP, 2 ts  INDEL<br> REF AT ALT GCA #INDEL, 1 del
INDEL<br>
REF AT ALT T #INDEL, 1 del #Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a Abase. #If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles. #Simple Indel classification should be invariant whether it is left or right aligned.
SV<br>
REF A
ALT &lt;DEL&gt; #SV
== Complex Biallelic Examples ==
SNP|INDEL<br>
REF AT ALT G #SNP, INDEL, 1 ts #Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually #not defined. In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which #is a transversion. In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition #and transversion contribution. But please be very clear that this is an ambiguous case. It is better to consider this simply #as a complex variant.
MNP|INDEL<br>
REF ATT ALT GCGG #MNP, INDEL, 1 ts, 1 tv, 1 del
MNP|CLUMPED<br>
REF ATTTT ALT GTTTC #MNP, CLUMPED, 2 ts #since all the alleles are of the sample same length, classified as MNP too.
INDEL|CLUMPED<br>
REF ATTTTTTTT
ALT GTTTC #INDEL, CLUMPED, 2 ts, 1 del
== Simple Multiallelic Examples ==
SNP<br>
REF A ALT G #SNP, 1 ts ALT C #SNP, 1 tv
MNP<br>
REF AG ALT GC #MNP, 1 ts, 1 tv ALT CT #MNP, 2 tv
INDEL<br>
REF ATTT
ALT ATT #INDEL, 1 del ALT ATATTTT #INDEL, 1 ins
== Complex Multiallelic Examples ==
SNP|MNP<br>
REF AT
ALT GT #SNP, 1 ts ALT AC #SNP, 1 ts #since all the alleles are of the sample length, classified as MNP too.
SNP|MNP|CLUMPED<br>
REF ATTTG
ALT GTTTC #CLUMPED, 1 ts, 1 tv ALT ATTTC #CLUMPEDSNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP #since all the alleles are of the sample length, classified as MNP too.
SNP|MNP|INDEL<br>
REF GT
ALT CT #SNP, 1 tv ALT AG #MNP, 2 tv ALT GTT #INDEL, 1 ins
SNP|MNP|INDEL|CLUMPED<br>
REF GTTT
ALT CG #MNP|, INDEL, 2 tv, 1 del ALT AG #MNP, INDEL, 1 ts, 1 tv ALT GTGTG #SNP|, INDEL|, CLUMPED, 1 tv, 1 ins == Structured Variants Examples ==  SV<br> REF G ALT &lt;INS:ME:LINE1&gt; #SV SV<br> REF G ALT &lt;CN4&gt; #SV ALT &lt;CN12&gt; #SV
== SV Examples =Interesting Variant Types =
======= Structural variants ======== no Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. of structural variants : 41217 2 alleles : 38079 deletion : 13135 &lt;DEL&gt; insertion : 16451 &lt;INS&gt; mobile element : 16253 &lt;INS:ME&gt; ALU : 12513 &lt;INS:ME:ALU&gt; LINE1 : 2911 &lt;INS:ME:LINE1&gt; SVA : 829 &lt;INS:ME:SVA&gt; numt : 198 &lt;INS:MT&gt; duplication : 664 &lt;DUP&gt; inversion : 100 &lt;INV&gt; copy number variation : 7729 &lt;CN4&gt; <br>=3 alleles : 3138 copy number variation : 3138 &lt;CN4&gt;,&lt;CN8&gt;
20 9538655 <span style= Output "color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> <STR>  This can be induced as one record considering only the ATTT repeats 20 9538655 <span style="color:#FF0000">ATTTATTTATTT </span> <span style="color:#FF0000">ATTT </span>  one record with CATT repeats 20 9538695 <span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>  one record with a mix of both repeat types 20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span> = Representation of close by variants =  1:124001690 TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG  a single complex variant CHROM POS REF ALT 1 124001690 C AAA
Summarizes the variants in a VCF file an Indel and SNP adjacent to one another CHROM POS REF ALT 1 124001689 T TAA 1 124001690 C A
<div class=Representing it as a single complex variant enforces that both " mw-collapsible mw-collapsedindel">and "SNP" are always together. #summarizes the Representing it as 2 separate variants found in mills.vcf vt peek millsallows both alleles to segregate independently.vcf
<div class="mw-collapsible-content"> usage : vt peek [options] <in.vcf>Output =
options : -o This is the annotated output VCF file [-] -I file containing list of intervals [] -i intervals [] -r reference sequence fasta file [] -- ignores the rest of peek in the labeled arguments following this flag -h displays help </div></div>vt suite.
#This is a sample output of a peek command which summarizes the variants found in a VCF file. stats: no. of samples : 0 #number of genotype fields in VCF file, this is a site list so it is 0 no. of chromosomes : 25 #no. of chromosomes observed in this file.<br>
========== Micro variants ========== <br>
no. of SNP : 54247827#total number of SNPs 2 alleles : 53487808 (1.99) [35616038/17871770] (-nan) [0#ts/0]tv ratio and the respective counts 3 alleles : 389190 (0.60) [291224/487156] (-nan) [0/0] 4 alleles : 370828 (0.50) [370828/741656] (-nan) [0/0] >=5 alleles : 1 (0.33) [1/3] (-nan) [0/0] <br>
no. of MNP : 122125
2 alleles : 121849 (1.56) [152383/97816] (-nan) [0/0] 3 alleles : 273 (0.89) [537/601] (-nan) [0/0] 4 alleles : 3 (1.00) [9/9] (-nan) [0/0] <br> no. of Indel : 6600770 #also referred to as simple Indels 2 alleles : 6285861 (-nan) [0/0] (0.88) [2937096/3348765]#ins/del ratio and the respective counts 3 alleles : 280892 (-nan) [0/0] (8.72) [503977/57807] 4 alleles : 28245 (-nan) [0/0] (131.19) [84094/641] >=5 alleles : 5772 (-nan) [0/0] (3847.00) [23082/6] <br>
no. of SNP/MNP : 1161
3 alleles : 1143 (1.57) [1565/994] (-nan) [0/0] 4 alleles : 15 (1.36) [34/25] (-nan) [0/0] >=5 alleles : 3 (0.67) [8/12] (-nan) [0/0] <br>
no. of SNP/Indel : 115153
2 alleles : 42717 (0.65) [16778/25939] (0.57) [15441/27276] #ts/tv and ins/del ratios
3 alleles : 66401 (0.72) [29681/41397] (0.33) [31458/96168]
4 alleles : 4631 (0.55) [2420/4386] (0.25) [2602/10306]
4 alleles : 85 (0.35) [71/203] (0.28) [31/111]
>=5 alleles : 21 (0.35) [24/68] (0.68) [25/37]<br>
no. of Clumped : 0 <br>
no. of SNP/Clumped : 0 <br>
no. of MNP/Clumped : 61175
2 alleles : 60617 (1.68) [84410/50220] (-nan) [0/0] 3 alleles : 549 (1.23) [1777/1449] (-nan) [0/0] 4 alleles : 8 (1.43) [53/37] (-nan) [0/0] >=5 alleles : 1 (1.00) [5/5] (-nan) [0/0] <br>
no. of SNP/MNP/Clumped : 290
3 alleles : 282 (1.35) [665/494] (-nan) [0/0] 4 alleles : 8 (0.57) [13/23] (-nan) [0/0] <br>
no. of Indel/Clumped : 27638
2 alleles : 25971 (0.65) [31435/48526] (0.79) [11444/14527]
no. of Reference : 0 <br>
====== Other useful categories ===== <br>
no. of Block Substitutions : 184751#equivalent to categories with allele lengths that are the same. 2 alleles : 182466 (1.60) [236793/148036] (-nan) [0/0] 3 alleles : 2247 (1.28) [4544/3538] (-nan) [0/0] 4 alleles : 34 (1.16) [109/94] (-nan) [0/0] >=5 alleles : 4 (0.76) [13/17] (-nan) [0/0] <br> no. of Complex Substitutions : 159298#equivalent to categories not including SNPs, Block Substitutions and Simple Indels
2 alleles : 81508 (0.61) [60312/98113] (0.66) [32479/49029]
3 alleles : 71003 (0.69) [35811/51840] (0.34) [34268/100942]
4 alleles : 5265 (0.49) [2924/5975] (0.30) [3375/11122]
>=5 alleles : 1522 (0.58) [1381/2369] (0.15) [757/5143] <br>
======= Structural variants ========<br> no. of structural variants : 41217 2 alleles : 38079 deletion : 13135 insertion : 16451 mobile element : 16253 ALU : 12513 LINE1 : 2911 SVA : 829 numt : 198 duplication : 664 inversion : 100 copy number variation : 7729 >=3 alleles : 3138 copy number variation : 3138 <br> ========= General summary ========== <br> no. of reference : 0 <br> no. of observed variants : 79449759 no. of unclassified variants : 0 = Implementation = This is implemented in [http://genome.sph.umich.edu/wiki/Vt#Peek vt].
= Maintained by =
This page is maintained by [mailto:atks@umich.edu Adrian].
1,102
edits

Navigation menu