Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

312 bytes added, 11:42, 29 January 2016
Interesting Variant Types
=Interesting Variant Types =
SVAdjacent Tandem Repeats from lobSTR's tandem repeat finder panel. <br> REF G ALT &lt;INS:ME:LINE1&gt; #SV
SV20 9538655 . ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTCATTCATTCATTCATTCATTCATTC <brSTR> REF G 20 9538655 . ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTCATTCATTCATTCATTCATTCATTC <STR>   ALT &lt;CN4&gt; #SV20 56664632 . AAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG <STR> ALT &lt;CN12&gt; #SV20 56664632 . AAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG <STR>
= Output =
1,102
edits

Navigation menu