Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

238 bytes removed, 10:44, 29 January 2016
Interesting Variant Types
Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. <br>
20 9538655 . ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTCATTCATTCATTCATTCATTCATTC <STR>
20 9538655 . ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTCATTCATTCATTCATTCATTCATTC <STR>
20 56664632 . AAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG 9538655 <STRspan style="color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> 20 56664632 . AAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG <STR>
= Output =
1,102
edits

Navigation menu