Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

259 bytes added, 10:48, 29 January 2016
Interesting Variant Types
20 9538655 <span style="color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> <STR>
 
This can be induced as
one record considering only the ATTT repeats
20 9538655 ATTTATTTATTT ATTT
 
one record with CATT repeats
20 9538695 CATTCATT CATT
 
one record with a mix of both repeat types
20 9538695 TATTCATTCATT CATT
= Output =
1,102
edits

Navigation menu