From Genome Analysis Wiki
Jump to navigationJump to search
501 bytes added
, 18:57, 25 February 2016
Line 13: |
Line 13: |
| | | |
| === Shifting === | | === Shifting === |
| + | |
| + | Consider the motifs ACTT, TACT and TTAC, the following stretches can be observed in the genome |
| + | |
| + | GGGGGGACTTACTTACTTACTTACTTAGGGGG |
| + | GGGGGGTACTTACTTACTTACTTACTTGGGGG |
| + | GGGGGGTTACTTACTTACTTACTTACTGGGGG |
| + | |
| + | but looking from the right flank, they can easily be CTTA, ACTT and TACT respectively. |
| + | |
| + | The concept of shifting the sequence is useful for grouping such like motifs together. |
| + | |
| + | We define shift as follow |
| + | |
| + | A shift of a sequence is the sliding of the sequence with the alleles wrapped to the front? |
| | | |
| === Reverse Complement === | | === Reverse Complement === |