Changes

From Genome Analysis Wiki
Jump to: navigation, search

Tandem Repeat Concepts

279 bytes added, 19:00, 25 February 2016
Fractional counts
== Fractional counts ==
 
While it is natural to think of a stretch of repeat as a integer, it is useful to consider fractional counts of a repeat especially in large repeat tracts.
This is done in Tandem Repeat Finder.
 
GGGTTAAGGGTTAAGGGTTAAGGGTTAAGGGTTAAGGG
 
This is 5.5 copies of the repeat GGGTTAA
== Scoring ==
1,102
edits

Navigation menu