Changes

From Genome Analysis Wiki
Jump to: navigation, search

Tandem Repeat Concepts

5,049 bytes added, 19:17, 25 February 2016
Detection of a motif in a sequence
== Detection of a motif in a sequence ==
The following shows the trace of how the algorithm works
============================================
ANNOTATING INDEL FUZZILY
********************************************
EXTRACTIING REGION BY EXACT LEFT AND RIGHT ALIGNMENT
20:131948:C/CCA
EXACT REGION 131948-131965 (18)
CCACACACACACACACAA
FINAL EXACT REGION 131948-131965 (18)
CCACACACACACACACAA
********************************************
PICK CANDIDATE MOTIFS
Longest Allele : C[CA]CACACACACACACACAA
detecting motifs for an str
seq: CCACACACACACACACACAA
len : 20
cmax_len : 10
candidate motifs: 25
AC : 0.894737 2 0
AAC : 0.5 3 0.0555556
ACC : 0.5 3 0.0555556
AAAC : 0.0588235 4 0.125 (< 2 copies)
ACCC : 0.0588235 4 0.125 (< 2 copies)
AACAC : 0.5 5 0.02
ACACC : 0.5 5 0.02
AAACAC : 0.0666667 6 0.0555556 (< 2 copies)
ACACCC : 0.0666667 6 0.0555556 (< 2 copies)
AACACAC : 0.5 7 0.0102041
ACACACC : 0.5 7 0.0102041
AAACACAC : 0.0769231 8 0.03125 (< 2 copies)
ACACACCC : 0.0769231 8 0.03125 (< 2 copies)
AACACACAC : 0.5 9 0.00617284 (< 2 copies)
ACACACACC : 0.5 9 0.00617284 (< 2 copies)
AAACACACAC : 0.0909091 10 0.02 (< 2 copies)
ACACACACCC : 0.0909091 10 0.02 (< 2 copies)
********************************************
PICKING NEXT BEST MOTIF
selected: AC 0.89 0.00
********************************************
DETECTING REPEAT TRACT FUZZILY
++++++++++++++++++++++++++++++++++++++++++++
Exact left/right alignment
repeat_tract : CACACACACACACACA
position : [131949,131964]
motif_concordance : 1
repeat units : 8
exact repeat units : 8
total no. of repeat units : 8
++++++++++++++++++++++++++++++++++++++++++++
Fuzzy right alignment
repeat motif : CA
rflank : AACTC
mlen : 2
rflen : 5
plen : 111
read : AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACACCACACACACACACACAAACTC
rlen : 106
optimal score: 50.5073
optimal state: MR
optimal track: MR|r|0|5
optimal probe len: 25
optimal path length : 107
max j: 106
probe: (1~82) [1~10] (1~5)
read : (1~82) [83~101] (102~106)
motif # : 10 [83,101]
motif concordance : 95% (9/10)
motif discordance : 0|1|0|0|0|0|0|0|0|0
Model: ----------------------------------------------------------------------------------CACACACACACACACACACAAACTC
SYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYMMMDMMMMMMMMMMMMMMMMMMMMME
oo++oo++oo++oo++oo++RRRRR
Read: AGAAATGATAGTCACTTCAACAGATGGTGTTGGGAAAACTGGATTTCCACAGGCAGAACAAATGAAATGGATCCTTATCTTACAC-CACACACACACACACAAACTC
++++++++++++++++++++++++++++++++++++++++++++
Fuzzy left alignment
lflank : ATCTTA
repeat motif : CA
lflen : 6
mlen : 2
plen : 111
read : ATCTTACACCACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT
rlen : 105
optimal score: 50.5858
optimal state: Z
optimal track: Z|m|10|2
optimal probe len: 26
optimal path length : 106
max j: 105
mismatch penalty: 3
model: (1~6) [1~10]
read : (1~6) [7~25][26~106]
motif # : 10 [7,25]
motif concordance : 95% (9/10)
motif discordance : 0|1|0|0|0|0|0|0|0|0
Model: ATCTTACACACACACACACACACACA--------------------------------------------------------------------------------
SMMMMMMMMMDMMMMMMMMMMMMMMMMZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZE
LLLLLLoo++oo++oo++oo++oo++
Read: ATCTTACAC-CACACACACACACACAAACTCAAAATGGATTTAAAGACTTAAATGTGAGCCTGGCAAACTTAAAACTCCTAAAATAAAACAGAAGGGAATATCTTT
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
VNTR Summary
rid : 19
motif : AC
ru : CA
Exact
repeat_tract : CACACACACACACACA
position : [131949,131964]
reference repeat unit length : 8
motif_concordance : 1
repeat units : 8
exact repeat units : 8
total no. of repeat units : 8
Fuzzy
repeat_tract : CACCACACACACACACACA
position : [131946,131964]
reference repeat unit length : 19
motif_concordance : 0.95
repeat units : 19
exact repeat units : 9
total no. of repeat units : 10
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
== Model free left alignment and right alignment ==
1,102
edits

Navigation menu