Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

346 bytes added, 20:40, 25 February 2016
Representation of close by variants
= Representation of close by variants =
CATACTATATATAGCCTCCA1:124001690 TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG  HaplotypeCaller - a single complex variant CHROM POS REF ALT 1 124001690 C AAA  vt - an Indel and SNP adjacent to one another CHROM POS REF ALT 1 124001689 T TAA 1 124001690 C A
= Output =
1,102
edits

Navigation menu