Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

167 bytes added, 20:44, 25 February 2016
Representation of close by variants
TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG
HaplotypeCaller - a single complex variant
CHROM POS REF ALT
1 124001690 C AAA
vt - an Indel and SNP adjacent to one another
CHROM POS REF ALT
1 124001689 T TAA
1 124001690 C A
 
Representing it as a single complex variant enforces that both "indel" and "SNP" are always together.
Representing it as 2 separate variants allows both alleles to segregate independently.
= Output =
1,102
edits

Navigation menu