[[Category:Software|BambamUtil]][[Category:libbamC++]]= bam Executable =When the pipeline is compiled, the SAM/BAM executable, "bam" is generated in the pipeline/bam/ directory.[[Category:Software]]
The software reads the beginning of an input file to determine if it is SAM/BAM. To determine the format (SAM/BAM) of the output file, the software checks the output file's extension. If the extension is ".bam" it writes a BAM file, otherwise it writes a SAM file.= bamUtil Overview =
The bam executable has the following functions.* [[C++ Executable: bam#validate|validate - Read and Validate bamUtil is a repository that contains several programs that perform operations on SAM/BAM file]]* [[C++ Executable: bam#convert|convert - Read a SAM/BAM file and write as a SAM/BAM file]]* [[C++ Executable: bam#dumpHeader|dumpHeader - Print SAM/BAM header]]* [[C++ Executable: bam#splitChromosome|splitChromosome - Split BAM by Chromosome]]* [[C++ Executable: bam#writeRegion|writeRegion - Write the alignments in the indexed BAM file that fall files. All of these programs are built into the specified region]]* [[C++ Executable: bam#dumpRefInfo|dumpRefInfo - Print SAM/BAM Reference Information]]* [[C++ Executable: bam#dumpIndex|dumpIndex - Dump a BAM index file into an easy to read text version]]* [[C++ Executable: single executable, <code>bam#readIndexedBam|readIndexedBam - Read an indexed BAM file reference by reference id -1 to the max reference id and write it out as a SAM</BAM file]]* [[C++ Executable: bam#filter|filter - Filter reads by clipping ends with too high of a mismatch percentage and by marking reads unmapped if the quality of mismatches is too high]]* [[C++ Executable: bam#readReference|readReference - Print the reference string for the specified region]]code>.
This executable is built using the [[C++ Library: bam|bam library]].
Just running ./bam will print the Usage information for the bam executable.== Getting Help ==
If you have any questions please use the [https://github.com/statgen/bamUtil bamUtil GitHub page] to raise and issue.
== validate ==See [[BamUtil: FAQ]] to see if your question has already been answered.
The <code>validate</code> option on the bam executable reads and validates a SAM/BAM file. This option is documented at: [[BamValidator]]== Where to Find It =={{ToolGitRepo|repoName=bamUtil}}
== convert Releases ==The <code>convert</code> option on the bam executable reads a SAM/BAM file and writes it as a SAM/BAM file.
The executable converts the input file into If you prefer to run the format of last official release rather than the output file. So if you want to convert a BAM file to a SAM filelatest development version, from the pipeline/bam/ directory you just call: ./bam --in <bamFile>.bam --out <newSamFile>.samDon't forget to put in the paths to the executable and your test filescan download that here.
=== Parameters ===<pre> Required Parameters: --in : There are two versions of the SAM/BAM file release, one that include libStatGen and one that does not. If you already have libStatGen installed and want to be read --out : use your own copy, use the SAM/BAM file to be written Optional Parameters: --noeof : do version that does not expect an EOF block on a bam fileinclude libStatGen.</pre>
=== Usage Full Release (includes libStatGen) === ./bam convert --in <inputFile> --out <outputFile.sam/bam/ubam (ubam is uncompressed bam)> [--noeof]
=== Return Value ===Returns To install an official release, unpack the SamStatus for downloaded file (tar xvf), cd into the reads/writesbamUtil_x.x.x directory and type make all.
=== Example Output ===<pre>Number of records read = 10Number of records written = 10</pre>For version 1.0.14 and later, please download libStatGen and bamUtil separately:
== dumpHeader =='''Version 1.0.14 - Released 7/8/2015'''*[[LibStatGen Download#Official Releases|libStatGen version 1.0.14]]The <code>dumpHeader</code> option on the bam executable prints the header *[[#Release of the specified SAM/BAM file to coutjust BamUtil (does not include libStatGen)|bamUtil version 1.0. 14]]
=== Parameters ===
<pre>
Required Parameters:
filename : the sam/bam filename whose header should be printed.
</pre>
=== Usage ==='''Older Releases'''* [[Media:BamUtilLibStatGen.1.0.13.tgz|BamUtilLibStatGen.1.0.13.tgz]] - Released 2/20/2015** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.13]] - see link for version updates** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.13]] - see link for version updates
./bam dumpHeader <inputFile>
=== Return Value ===* [[Media:BamUtilLibStatGen.1.0.12.tar.gz|BamUtilLibStatGen.1.0.12.tgz]] - Released 5/14/2014* * Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0: the header was successfully read and printed.12]] - see link for version updates* non-0* Contains: the header was [[#Release of just BamUtil (does not successfully read or was not printedinclude libStatGen)|bamUtil version 1.0. (Returns 12]] - see link for version updates** Adds regions to [[BamUtil: mergeBam|mergeBam]]** Accept ',' delimiters for the SamStatus.)tags string input in [[BamUtil: squeeze|squeeze]], [[BamUtil: revert|revert]], & [[BamUtil: diff|diff]]
*[[Media:BamUtilLibStatGen.1.0.11.tar.gz|BamUtilLibStatGen.1.0.11.tar.gz]] - Released 2/28/2014
** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.11]] - see link for version updates
** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.11]] - see link for version updates
** Now properly supports 'B' & 'f' tags
** Cleanup - compile issues
=== Example Output ===<pre>@SQ SN*[[Media:BamUtilLibStatGen.1.0.10.tar.gz|BamUtilLibStatGen.1 LN:247249719.0.10.tar.gz]] - Released 1/2/2014@SQ SN** Contains:2 LN:242951149[[LibStatGen Download#Official Releases|libStatGen version 1.0.10]] - see link for version updates@SQ SN** Contains:3 LN:199501827[[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.10]] - see link for version updates<** Adds PhoneHome/pre>Version checking.
*[[Media:BamUtilLibStatGen.1.0.9.tgz|BamUtilLibStatGen.1.0.9.tgz]] - Released 7/7/2013
** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.9]]
** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.9]]
** Update to [[BamUtil: mergeBam|mergeBam]]
*** Update to ignore PG lines with duplicate IDs
*** Update to accept merges of matching RG lines
*** Update to log to stderr if no log/out file is specified
* There is no version 1.0.8. It was skipped to stay in line with libStatGen versions (libStatGen 1.0.8 added vcf support)
*[[Media:BamUtilLibStatGen.1.0.7.tgz|BamUtilLibStatGen.1.0.7.tgz]] - Released 1/29/2013
** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.7]]
** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.7]]
** Update to fix some compile issues on ubuntu 12.10
** Update use of SamRecord::getStringTag to expect the return of a const string pointer due to libStatGen v1.0.7 updates
** Update SamReferenceInfo usage due to libStatGen v1.0.7 updates
** Update to [[BamUtil: diff|diff]]
*** Fix DIFF to test and properly handle running out of available records. Previously no message was printed when this happened and there was a bug for which file it freed
** Update to [[BamUtil: clipOverlap|clipOverlap]]
*** Update to facilitate adding other overlap handling functions
** Update to [[BamUtil: mergeBam|mergeBam]] (formerly RGMergeBam)
*** Rename RGMergeBam to MergeBam
*** Update to handle files that already have an RG
== *[[Media:BamUtilLibStatGen.1.0.6.tgz|BamUtilLibStatGen.1.0.6.tgz]] - Released 11/14/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.6]] ** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.6]]** Update to [[BamUtil: trimBam|trimBam]]*** Update to allow trimming a different number of bases from each end of the read*[[Media:BamUtilLibStatGen.1.0.5.tgz|BamUtilLibStatGen.1.0.5.tgz]] - Released 10/24/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.5]] ** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.5]]** Updates to: [[BamUtil: dedup|dedup]], [[BamUtil: polishBam|polishBam]], [[BamUtil: recab|recab]]** Update to add compile option to compile without C++0x/C++11** See [[#Release of just BamUtil (does not include libStatGen)|below]] for additional details on updates*BamUtilLibStatGen.1.0.4.tgz - Released skipped*[[Media:BamUtilLibStatGen.1.0.3.tgz|BamUtilLibStatGen.1.0.3.tgz]] - Released 09/19/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.3]] ** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.3]]** Adds: [[BamUtil: dedup|dedup]] [[BamUtil: recab|recab]]*[[Media:BamUtilLibStatGen.1.0.2.tgz|BamUtilLibStatGen.1.0.2.tgz]] - Released 05/16/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.2]] ** Adds: [[BamUtil: bam2FastQ|bam2FastQ]]*[[Media:BamUtilLibStatGen.1.0.1.tgz|BamUtilLibStatGen.1.0.1.tgz]] - Released 05/04/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.1]] ** Adds: [[BamUtil: splitBam|splitBam]], [[BamUtil: clipOverlap|clipOverlap]], [[BamUtil: trimBam|trimBam]], [[BamUtil: polishBam|polishBam]], [[BamUtil: rgMergeBam|rgMergeBam]], [[BamUtil: gapInfo|gapInfo]]** Adds additional functionality to [[BamUtil: stats|stats]]** Adds leftShifting to [[BamUtil: writeRegion|writeRegion]] and [[BamUtil: convert|convert]]** Adds more diff fields to [[BamUtil: diff|diff]]* [[Media:BamUtilLibStatGen.1.0.0.tgz|BamUtilLibStatGen.1.0.0.tgz]] - Released 10/10/2011**Initial release of bamUtil that includes libStatGen version 1.0.0. It started from the tool found in the deprecated StatGen repository.**Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.0]] [[BamUtil: validate|validate]], [[BamUtil: convert|convert]], [[BamUtil: dumpHeader|dumpHeader]], [[BamUtil: splitChromosome ==|splitChromosome]], [[BamUtil: writeRegion|writeRegion]], [[BamUtil: dumpRefInfo|dumpRefInfo]], [[BamUtil: dumpIndex|dumpIndex]], [[BamUtil: readIndexedBam|readIndexedBam]], [[BamUtil: filter|filter]], [[BamUtil: readReference|readReference]], [[BamUtil: revert|revert]], [[BamUtil: diff|diff]], [[BamUtil: squeeze|squeeze]], [[BamUtil: findCigars|findCigars]], [[BamUtil: stats|stats]]
The <code>splitChromosome</code> option on the bam executable splits an indexed BAM file into multiple files based on the Chromosome === Release of just BamUtil (Reference Namedoes not include libStatGen). ===
The files all have To install an official release, unpack the same base namedownloaded file (tar xvf), but with an _# where # corresponds with cd into the associated reference id from the BAM filebamUtil_x.x.x directory and type make all.
=== Parameters ==='''BamUtil.1.0.14 Release Notes'''<pre> Required Parameters: * BamUtil Version 1.0.14 --in : the SAMReleased 7/8/BAM file to be split2015 --out ** https: the base filename for the SAM/BAM files to write into/github.com/statgen/bamUtil/archive/v1.0.14.tar. Does gz** Requires, but does not include the extension: [[LibStatGen Download#Official Releases|libStatGen version 1. _N will be appended to the basename where N indicates the Chromosome0.14]] Optional Parameters** Update [[BamUtil:trimBam|trimBam]] *** Add option to soft clip (--noeof : do not expect an EOF block on a bam file.c) instead of trimming --bamIndex ** Update [[BamUtil: the path/name of the bam index fileclipOverlap|clipOverlap]] (*** Add option to mark reads as unmapped if not specified, uses the --in value + ".bai")they are entirely clipped --bamout ** Update to [[BamUtil: write bam2FastQ|bam2FastQ]]*** Add option to gzip the output files in BAM format (default). --samout *** Add option to split Read Groups into separate fastq files*** Add option to get the quality from a tag** Update [[BamUtil: write recab|recab]]*** Update to ignore ref 'N' when building the output files in SAM format.recalibration table*** Add ability to bin</pre>** Add Dedup_LowMem tool
=== Usage ==='''Older Releases'''* BamUtil Version 1.0.13 - Released 2/20/2015** https://github.com/statgen/bamUtil/archive/v1.0.13.tar.gz** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.13]]** Makefile Updates*** Improve logic to determine actual path for the library*** Update to append to USER_COMPILE_VARS even if specified on the command line** Update [[BamUtil: writeRegion|writeRegion]]*** Add option to specify readnames to keep in a file*** Fixed bug that if a read overlapped 2 BED positions, it was printed twice** Update to [[BamUtil: bam2FastQ|bam2FastQ]]*** Update to skip non-primary reads** Update to [[BamUtil: polishBam|polishBam]]*** Update to handle '\t' string inputs and to add CO option*** Fix MD5sum calculation to convert fasta to uppercase prior to calculating
* [[Media:BamUtil.1.0.12.tgz|BamUtil.1.0.12.tgz]] - Released 5/bam splitChromosome --in <inputFilename> --out <outputFileBaseName> 14/2014** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.12]]** Update [[BamUtil: mergeBam|mergeBam]]*** Add a regions option** Update to [[--bamIndex <bamIndexFile>BamUtil: squeeze|squeeze]] , [[--noeofBamUtil: revert|revert]] , [--bamout[BamUtil: diff|--samoutdiff]]*** Also accept ',' instead of just ';' as the delimiter in the input tags string.
* [[Media:BamUtil.1.0.11.tgz|BamUtil.1.0.11.tgz]] - Released 2/28/2014
** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.11]]
*** Adds support for 'B' & 'f' tags that did not work properly before.
** Update [[BamUtil: splitBam|splitBam]] & [[BamUtil: polishBam|polishBam]]
*** Update to work properly if log & output file are not specified (no longer creates '.log')
** Update Main dummy/example tool to indicate the correct tool
** Update to [[BamUtil: bam2FastQ|bam2FastQ]], [[BamUtil: clipOverlap|clipOverlap]], [[BamUtil: filter|filter]], [[BamUtil: mergeBam|mergeBam]], [[BamUtil: splitBam|splitBam]], [[BamUtil: squeeze|squeeze]], [[BamUtil: stats|stats]]
*** Cleanup usage/parameter descriptions
** Update [[BamUtil: revert|revert]]
*** Update compatibility with libStatGen due to 'B' & 'f' tag handling updates
** Add tests for 'B' & 'f' tags
=== Return Value ===* [[Media:BamUtil.1.0.10.tar.gz|BamUtil.1.0.10.tar.gz]] - Released 1/2/2014* * Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.10]]** All*** Add PhoneHome/version checking*** Make sub-program names case independent*** Fix Logger.cpp compiler warning** Adds: [[BamUtil: explainFlags|explainFlags]] - describes the SAM/BAM flags based on the flag value** Update to [[BamUtil: stats|stats]]*** Fix Stats to not try to not try to process a record after it is out of the loop (it would already have been processed or is invalid)** Update to [[BamUtil: splitBam|splitBam]]*** fix description of --noeof option** Update to [[BamUtil: all records are successfully read writeRegion|writeRegion]]*** add exclude/required flags** Update to [[BamUtil: dedup|dedup]] & [[BamUtil: recab|recab]]*** Ignore secondary reads for dedup and writtenmaking the recalibration table.* non-0** skip QC Failures*** add excludeFlags parameters** Update to [[BamUtil: at least one record was not successfully clipOverlap|clipOverlap]]*** add exclude flags*** fix bug for readName sorted when a read or writtenis filtered due to flags*** add sorting validation** Update to [[BamUtil: bam2FastQ|bam2FastQ]]*** add --merge option to generate interleaved files.*** update to open the input file before opening the output files, so if there is an error, the outputs aren't opened** Update to [[BamUtil: mergeBam|mergeBam]]*** add option to ignore the RG PI field when checking headers*** add more informative header merge error messages
=== Example Output ===* [[Media:BamUtil.1.0.9.tgz|BamUtil.1.0.9.tgz]] - Released 7/7/2013<pre>** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.9]] (version 1.0.7 should also work)The following parameters are available. Ones with "** Update to [[BamUtil: mergeBam|mergeBam]]" are in effect:*** Update to ignore PG lines with duplicate IDs*** Update to accept merges of matching RG lines*** Update to log to stderr if no log/out file is specified
Input Parameters*[[Media:BamUtil.1.0.7.tgz|BamUtil.1.0.7.tgz]] - Released 1/29/2013** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.7]] or above** Update to fix some compile issues on ubuntu 12.10** Update use of SamRecord::getStringTag to expect the return of a const string pointer due to libStatGen v1.0.7 updates** Update SamReferenceInfo usage due to libStatGen v1.0.7 updates** Update to [[BamUtil: diff|diff]]*** Fix DIFF to test and properly handle running out of available records. Previously no message was printed when this happened and there was a bug for which file it freed** Update to [[BamUtil: clipOverlap|clipOverlap]]*** Update to facilitate adding other overlap handling functions** Update to [[BamUtil: mergeBam|mergeBam]] (formerly RGMergeBam)*** Rename RGMergeBam to MergeBam*** Update to handle files that already have an RG*[[Media:BamUtil.1.0.6.tgz|BamUtil.1.0.6.tgz]] --in [testReleased 11/testFiles14/sortedBam2012** Update to [[BamUtil: trimBam|trimBam]]*** Update to allow trimming a different number of bases from each end of the read*[[Media:BamUtil.1.bam0.5.tgz|BamUtil.1.0.5.tgz]], -Released 10/24/2012** Update to [[BamUtil: dedup|dedup]]*** Update logic for which pair to keep if they have the same quality** Update to [[BamUtil: polishBam|polishBam]]*** Update to print the number of successful header additions** Update to [[BamUtil: recab|recab]]*** Update to print the number of base skipped due to the base quality** General Updates*** Update to add compile option to compile without C++0x/C++11*BamUtil.1.0.4.tgz -out Released skipped*[[chromosomeMedia:BamUtil.1.0.3.tgz|BamUtil.1.0.3.tgz]], --bamIndex Released 09/19/2012** Adds: [[BamUtil: dedup|dedup]] [[BamUtil: recab|recab]]** General Updates*** Update Logger to write to stderr if output is stdout** Update to [[BamUtil: stats|stats],]*** Add required/exclude flags*** Exclude Clips if excluding umapped *** Add --noeofwithinRegion flag*** Update phred/qual counts to be uint64_t instead of int to avoid overflow ** Update to [[BamUtil: validate|validate]]*** Detect header failures** Update to [[BamUtil: diff|diff]]*** Update to specify chromosome/pos in ZP as a string rather than int so both can be shown** Update to [[BamUtil: readReference|readReference]]*** Output Type error message if the reference name is not found** Update to [[BamUtil: splitChromosome|splitChromosome]]*** Update to actually split the chromosomes and not just hard coded to output chromosomes ids 0-22** Update Makefile to have cloneLib for cloning libStatGen*[[Media:BamUtil.1.0.2.tgz|BamUtil.1.0.2.tgz]] - Released 05/16/2012** Adds: [[BamUtil: bam2FastQ|bam2FastQ]]*[[Media:BamUtil.1.0.1.tgz|BamUtil.1.0.1.tgz]] -bamout Released 05/04/2012** Adds: [[BamUtil: splitBam|splitBam]], [ON[BamUtil: clipOverlap|clipOverlap]], [[BamUtil: trimBam|trimBam]], [[BamUtil: polishBam|polishBam]], [[BamUtil: rgMergeBam|rgMergeBam]], [[BamUtil: gapInfo|gapInfo]]** Adds additional functionality to [[BamUtil: stats|stats]]** Adds leftShifting to [[BamUtil: writeRegion|writeRegion]] and [[BamUtil: convert|convert]]** Adds more diff fields to [[BamUtil: diff|diff]]*[[Media:BamUtil.1.0.0.tgz|BamUtil.1.0.0.tgz]] --samoutReleased 10/10/2011**Initial release of just bamUtil. It started from the tool found in the deprecated StatGen repository.**Contains: [[BamUtil: validate|validate]], [[BamUtil: convert|convert]], [[BamUtil: dumpHeader|dumpHeader]], [[BamUtil: splitChromosome|splitChromosome]], [[BamUtil: writeRegion|writeRegion]], [[BamUtil: dumpRefInfo|dumpRefInfo]], [[BamUtil: dumpIndex|dumpIndex]], [[BamUtil: readIndexedBam|readIndexedBam]], [[BamUtil: filter|filter]], [[BamUtil: readReference|readReference]], [[BamUtil: revert|revert]], [[BamUtil: diff|diff]], [[BamUtil: squeeze|squeeze]], [[BamUtil: findCigars|findCigars]], [[BamUtil: stats|stats]]
Reference ID -1 has 2 records== Citation ==Reference ID 0 has 5 recordsIf you use BamUtil, please cite our publication on GotCloud which includes BamUtil: Reference ID 1 has 2 recordsReference ID 2 has 1 recordsReference ID 3 has 0 recordsReference ID 4 has 0 recordsReference ID 5 has 0 recordsReference ID 6 has 0 recordsReference ID 7 has 0 recordsReference ID 8 has 0 recordsReference ID 9 has 0 recordsReference ID 10 has 0 recordsReference ID 11 has 0 recordsReference ID 12 has 0 recordsReference ID 13 has 0 recordsReference ID [http://genome.cshlp.org/content/early/2015/04/14 has 0 recordsReference ID 15 has 0 recordsReference ID 16 has 0 recordsReference ID 17 has 0 recordsReference ID 18 has 0 recordsReference ID 19 has 0 recordsReference ID 20 has 0 recordsReference ID 21 has 0 recordsReference ID 22 has 0 recordsNumber of records = 10Returning: 0 /gr.176552.114.abstract Jun, Goo, et al. "An efficient and scalable analysis framework for variant extraction and refinement from population scale DNA sequence data." Genome research (SUCCESS2015)</pre>: gr-176552.]
== writeRegion =Programs =
The <code>writeRegion</code> option on software reads the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position). === Parameters ===<pre> Required Parameters: --in : the BAM beginning of an input file to be read --out : the determine if it is SAM/BAM file to write to Optional Parameters: --noeof : do not expect an EOF block on a bam file. --bamIndex : the path/name of the bam index file (if not specified, uses the --in value + ".bai") --refName : To determine the BAM reference Name to read format (either this or refID can be specified) --refID : the SAM/BAM reference ID to read (defaults to -1: unmapped) --start : the 0-based start position (defaults to -1) --end : the 0-based end position (defaults to -1: meaning til the end of the reference)</pre> === Usage === ./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] === Return Value ===* 0: all records are successfully read and written.* non-0: at least one record was not successfully read or written. === Example Output ===<pre>The following parameters are available. Ones with "[]" are in effect: Input Parameters --in [test/testFiles/sortedBam.bam]output file, --out [t.sam], --bamIndex [], --refName [], --refID, --start [1], --end [100], --noeof Wrote t.sam with 2 records.</pre> == dumpRefInfo ==The <code>dumpRefInfo</code> option on the bam executable prints software checks the SAM/BAM output file's reference informationextension. === Parameters ===<pre> Required Parameters: --in : the SAM/BAM file to be read Optional Parameters: --noeof : do not expect an EOF block on a bam file. --printRecordRefs : print If the reference information for the records in the file (grouped by reference).</pre> === Usage === ./bam dumpRefInfo --in <inputFilename> [--noeof] [--printRecordRefs] === Return Value ===* 0: the file was processed successfullyextension is ".* non-0: the file was not processed successfully. == dumpIndex ==The <code>dumpIndex</code> option on the bam executable prints " it writes a BAM index file in an easy to read format. === Parameters ===<pre> Required Parameters: --bamIndex : the path/name of the bam index file to display Optional Parameters: --refID : the reference ID to read, defaults to print all --summary : only print a summary - 1 line per reference.</pre> === Usage === ./bam dumpIndex --bamIndex <bamIndexFile> [--refID <ref#>] [--summary] === Return Value ===* 0: the BAM index file was processed successfully.* non-0: the BAM index file was not processed successfully. == readIndexedBam ==The <code>readIndexedBam</code> option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and otherwise it writes it out as a SAM/BAM file. === Parameters ===<pre> Required Parameters: inputFilename - path/name of the input BAM file outputFile.sam/bam - path/name of the output file bamIndexFile - path/name of the BAM index file</pre> === Usage ===./bam readIndexedBam <inputFilename> <outputFile.sam/bam> <bamIndexFile> === Return Value ===* 0 == filter == The <code>filter</code> option on the bam executable filters the reads in a a SAM/BAM file. This option is documented at: [[Bam Executable: Filter]] == readReference ==The <code>readReference</code> option on the bam executable prints the specified region of the reference sequence in an easy to read format. === Parameters ===<pre> Required Parameters: --refFile : the reference --refName : the BAM reference Name to read (either this or refID can be specified) --start : inclusive 0-based start position (defaults to -1) Required Length Parameter (one but not both needs to be specified): --end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference) --numBases : number of bases from start to display</pre> === Usage === ./bam readReference --refFile <referenceFilename> --refName <reference Name>--start <0 based start> --end <0 based end>|--numBases <number of bases> === Return Value ===* 0: the reference file was successfully read.* non-0: the reference file was not successfully read. === Example Output ===<pre>The following parameters are available. Ones with "[]" are in effect:Input Parameters --refFile [/home/mktrost/data/human.g1k.v37.fa], --refName [1], --start [43000], --end [-1], --numBases [71]
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA</pre>{{BamUtilPrograms}}