Changes

From Genome Analysis Wiki
Jump to: navigation, search

BamUtil

643 bytes removed, 13:00, 13 October 2010
no edit summary
=== Example Output ===
<pre>
The following parameters are available. Ones with "[]" are in effect:
 
Input Parameters
--in [test/testFiles/sortedBam.bam], --out [chromosome], --bamIndex [],
--noeof
Output Type : --bamout [ON], --samout
 
Reference ID -1 has 2 records
Reference ID 0 has 5 records
=== Example Output ===
<pre>
The following parameters are available. Ones with "[]" are in effect:
 
Input Parameters
--in [test/testFiles/sortedBam.bam], --out [t.sam], --bamIndex [],
--refName [], --refID, --start [1], --end [100], --noeof
Wrote t.sam with 2 records.
=== Example Output ===
<pre>
The following parameters are available. Ones with "[]" are in effect:
Input Parameters
--refFile [/home/mktrost/data/human.g1k.v37.fa], --refName [1],
--start [43000], --end [-1], --numBases [71]
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.
GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA
</pre>

Navigation menu