[[Category:bamUtil]]
[[Category:C++]]
[[Category:Software]]
[[Category:C++]]
[[Category:libStatGen]]
[[Category:libStatGen BAM]]
= bam Executable bamUtil Overview =When statgen is compiled, the SAM/BAM executable, "bam" is generated in the statgen/src/bin/ directory.
The software reads the beginning of an input file to determine if it bamUtil is a repository that contains several programs that perform operations on SAM/BAMfiles. To determine the format (SAM/BAM) All of the output filethese programs are built into a single executable, the software checks the output file's extension. If the extension is ".<code>bam" it writes a BAM file, otherwise it writes a SAM file</code>.
The bam executable has the following functions.
* [[C++ Executable: bam#validate|validate - Read and Validate a SAM/BAM file]]
* [[C++ Executable: bam#convert|convert - Read a SAM/BAM file and write as a SAM/BAM file]]
* [[C++ Executable: bam#dumpHeader|dumpHeader - Print SAM/BAM header]]
* [[C++ Executable: bam#splitChromosome|splitChromosome - Split BAM by Chromosome]]
* [[C++ Executable: bam#writeRegion|writeRegion - Write the alignments in the indexed BAM file that fall into the specified region]]
* [[C++ Executable: bam#dumpRefInfo|dumpRefInfo - Print SAM/BAM Reference Information]]
* [[C++ Executable: bam#dumpIndex|dumpIndex - Dump a BAM index file into an easy to read text version]]
* [[C++ Executable: bam#readIndexedBam|readIndexedBam - Read an indexed BAM file reference by reference id -1 to the max reference id and write it out as a SAM/BAM file]]
* [[C++ Executable: bam#filter|filter - Filter reads by clipping ends with too high of a mismatch percentage and by marking reads unmapped if the quality of mismatches is too high]]
* [[C++ Executable: bam#readReference|readReference - Print the reference string for the specified region]]
This executable is built using [[StatGenLibrary: bam]].== Getting Help ==
Just running If you have any questions please use the [https://github.com/statgen/bam will print the Usage information for the bam executablebamUtil bamUtil GitHub page] to raise and issue.
See [[BamUtil: FAQ]] to see if your question has already been answered.
== validate Where to Find It =={{ToolGitRepo|repoName=bamUtil}}
The <code>validate</code> option on the bam executable reads and validates a SAM/BAM file. This option is documented at: [[BamValidator]]== Releases ==
== convert ==The <code>convert</code> option on If you prefer to run the bam executable reads a SAM/BAM file and writes it as a SAM/BAM filelast official release rather than the latest development version, you can download that here.
The executable converts the input file into the format There are two versions of the output filerelease, one that include libStatGen and one that does not. So if If you already have libStatGen installed and want to convert a BAM file to a SAM fileuse your own copy, from the pipeline/bam/ directory you just call: ./bam --in <bamFile>.bam --out <newSamFile>.samDon't forget to put in use the paths to the executable and your test filesversion that does not include libStatGen.
=== Parameters Full Release (includes libStatGen) ===<pre> Required Parameters: --in : the SAM/BAM file to be read --out : the SAM/BAM file to be written Optional Parameters: --noeof : do not expect an EOF block on a bam file. --params : print the parameter settings</pre>
=== Usage === To install an official release, unpack the downloaded file (tar xvf), cd into the bamUtil_x./bam convert --in <inputFile> --out <outputFilex.x directory and type make all.sam/bam/ubam (ubam is uncompressed bam)> [--noeof] [--params]
For version 1.0.14 and later, please download libStatGen and bamUtil separately:
=== Return Value ===
Returns the SamStatus for the reads/writes.
=== Example Output ===<pre>'''Version 1.0.14 - Released 7/8/2015'''Number of records read = 10*[[LibStatGen Download#Official Releases|libStatGen version 1.0.14]]Number *[[#Release of records written = 10</pre>just BamUtil (does not include libStatGen)|bamUtil version 1.0.14]]
== dumpHeader =='''Older Releases'''The <code>dumpHeader<* [[Media:BamUtilLibStatGen.1.0.13.tgz|BamUtilLibStatGen.1.0.13.tgz]] - Released 2/code> option on the bam executable prints the header 20/2015** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.13]] - see link for version updates** Contains: [[#Release of the specified SAM/BAM file to coutjust BamUtil (does not include libStatGen)|bamUtil version 1.0. 13]] - see link for version updates
=== Parameters ===
<pre>
Required Parameters:
filename : the sam/bam filename whose header should be printed.
</pre>
=== Usage ===* [[Media:BamUtilLibStatGen.1.0.12.tar.gz|BamUtilLibStatGen.1.0.12.tgz]] - Released 5/14/2014** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.12]] - see link for version updates** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.12]] - see link for version updates** Adds regions to [[BamUtil: mergeBam|mergeBam]]** Accept ',' delimiters for the tags string input in [[BamUtil: squeeze|squeeze]], [[BamUtil: revert|revert]], & [[BamUtil: diff|diff]]
*[[Media:BamUtilLibStatGen.1.0.11.tar.gz|BamUtilLibStatGen.1.0.11.tar.gz]] - Released 2/28/bam dumpHeader <inputFile>2014** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.11]] - see link for version updates** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.11]] - see link for version updates** Now properly supports 'B' & 'f' tags** Cleanup - compile issues
=== Return Value ===*[[Media:BamUtilLibStatGen.1.0.10.tar.gz|BamUtilLibStatGen.1.0.10.tar.gz]] - Released 1/2/2014* * Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0: the header was successfully read and printed.10]] - see link for version updates* non-0* Contains: the header was [[#Release of just BamUtil (does not successfully read or was not printedinclude libStatGen)|bamUtil version 1.0. (Returns the SamStatus10]] - see link for version updates** Adds PhoneHome/Version checking.)
*[[Media:BamUtilLibStatGen.1.0.9.tgz|BamUtilLibStatGen.1.0.9.tgz]] - Released 7/7/2013
** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.9]]
** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.9]]
** Update to [[BamUtil: mergeBam|mergeBam]]
*** Update to ignore PG lines with duplicate IDs
*** Update to accept merges of matching RG lines
*** Update to log to stderr if no log/out file is specified
* There is no version 1.0.8. It was skipped to stay in line with libStatGen versions (libStatGen 1.0.8 added vcf support)
*[[Media:BamUtilLibStatGen.1.0.7.tgz|BamUtilLibStatGen.1.0.7.tgz]] - Released 1/29/2013
** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.7]]
** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.7]]
** Update to fix some compile issues on ubuntu 12.10
** Update use of SamRecord::getStringTag to expect the return of a const string pointer due to libStatGen v1.0.7 updates
** Update SamReferenceInfo usage due to libStatGen v1.0.7 updates
** Update to [[BamUtil: diff|diff]]
*** Fix DIFF to test and properly handle running out of available records. Previously no message was printed when this happened and there was a bug for which file it freed
** Update to [[BamUtil: clipOverlap|clipOverlap]]
*** Update to facilitate adding other overlap handling functions
** Update to [[BamUtil: mergeBam|mergeBam]] (formerly RGMergeBam)
*** Rename RGMergeBam to MergeBam
*** Update to handle files that already have an RG
=== Example Output ===*[[Media:BamUtilLibStatGen.1.0.6.tgz|BamUtilLibStatGen.1.0.6.tgz]] - Released 11/14/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.6]] ** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.6]]** Update to [[BamUtil: trimBam|trimBam]]*** Update to allow trimming a different number of bases from each end of the read*[[Media:BamUtilLibStatGen.1.0.5.tgz|BamUtilLibStatGen.1.0.5.tgz]] - Released 10/24/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.5]] ** Contains: [[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1.0.5]]** Updates to: [[BamUtil: dedup|dedup]], [[BamUtil: polishBam|polishBam]], [[BamUtil: recab|recab]]** Update to add compile option to compile without C++0x/C++11** See [[#Release of just BamUtil (does not include libStatGen)|below]] for additional details on updates*BamUtilLibStatGen.1.0.4.tgz - Released skipped*[[Media:BamUtilLibStatGen.1.0.3.tgz|BamUtilLibStatGen.1.0.3.tgz]] - Released 09/19/2012<pre>** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.3]] @SQ SN** Contains:[[#Release of just BamUtil (does not include libStatGen)|bamUtil version 1 LN.0.3]]** Adds: [[BamUtil: dedup|dedup]] [[BamUtil:247249719recab|recab]]@SQ SN*[[Media:BamUtilLibStatGen.1.0.2 LN.tgz|BamUtilLibStatGen.1.0.2.tgz]] - Released 05/16/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.2]] ** Adds: [[BamUtil: bam2FastQ|bam2FastQ]]*[[Media:BamUtilLibStatGen.1.0.1.tgz|BamUtilLibStatGen.1.0.1.tgz]] - Released 05/04/2012** Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.1]] ** Adds: [[BamUtil: splitBam|splitBam]], [[BamUtil: clipOverlap|clipOverlap]], [[BamUtil: trimBam|trimBam]], [[BamUtil:242951149polishBam|polishBam]], [[BamUtil: rgMergeBam|rgMergeBam]], [[BamUtil: gapInfo|gapInfo]]@SQ SN** Adds additional functionality to [[BamUtil:3 LNstats|stats]]** Adds leftShifting to [[BamUtil: writeRegion|writeRegion]] and [[BamUtil: convert|convert]]** Adds more diff fields to [[BamUtil:199501827diff|diff]]<* [[Media:BamUtilLibStatGen.1.0.0.tgz|BamUtilLibStatGen.1.0.0.tgz]] - Released 10/10/pre>2011**Initial release of bamUtil that includes libStatGen version 1.0.0. It started from the tool found in the deprecated StatGen repository.**Contains: [[LibStatGen Download#Official Releases|libStatGen version 1.0.0]] [[BamUtil: validate|validate]], [[BamUtil: convert|convert]], [[BamUtil: dumpHeader|dumpHeader]], [[BamUtil: splitChromosome|splitChromosome]], [[BamUtil: writeRegion|writeRegion]], [[BamUtil: dumpRefInfo|dumpRefInfo]], [[BamUtil: dumpIndex|dumpIndex]], [[BamUtil: readIndexedBam|readIndexedBam]], [[BamUtil: filter|filter]], [[BamUtil: readReference|readReference]], [[BamUtil: revert|revert]], [[BamUtil: diff|diff]], [[BamUtil: squeeze|squeeze]], [[BamUtil: findCigars|findCigars]], [[BamUtil: stats|stats]]
=== Release of just BamUtil (does not include libStatGen) ===
== splitChromosome ==To install an official release, unpack the downloaded file (tar xvf), cd into the bamUtil_x.x.x directory and type make all.
The <code>splitChromosome<'''BamUtil.1.0.14 Release Notes'''* BamUtil Version 1.0.14 - Released 7/8/2015** https:/code> /github.com/statgen/bamUtil/archive/v1.0.14.tar.gz** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.14]]** Update [[BamUtil: trimBam|trimBam]]*** Add option to soft clip (-c) instead of trimming** Update [[BamUtil: clipOverlap|clipOverlap]]*** Add option on to mark reads as unmapped if they are entirely clipped** Update to [[BamUtil: bam2FastQ|bam2FastQ]]*** Add option to gzip the bam executable splits an indexed BAM file output files*** Add option to split Read Groups into multiple separate fastq files based on *** Add option to get the Chromosome (Reference Name). quality from a tag** Update [[BamUtil: recab|recab]]*** Update to ignore ref 'N' when building the recalibration table*** Add ability to bin** Add Dedup_LowMem tool
The files all have the same base name'''Older Releases'''* BamUtil Version 1.0.13 - Released 2/20/2015** https://github.com/statgen/bamUtil/archive/v1.0.13.tar.gz** Requires, but with an _does not include: [[LibStatGen Download# where # corresponds with Official Releases|libStatGen version 1.0.13]]** Makefile Updates*** Improve logic to determine actual path for the associated reference id from library*** Update to append to USER_COMPILE_VARS even if specified on the BAM command line** Update [[BamUtil: writeRegion|writeRegion]]*** Add option to specify readnames to keep in a file.*** Fixed bug that if a read overlapped 2 BED positions, it was printed twice** Update to [[BamUtil: bam2FastQ|bam2FastQ]]*** Update to skip non-primary reads** Update to [[BamUtil: polishBam|polishBam]]*** Update to handle '\t' string inputs and to add CO option*** Fix MD5sum calculation to convert fasta to uppercase prior to calculating
=== Parameters ===<pre> Required Parameters* [[Media: BamUtil.1.0.12.tgz|BamUtil.1.0.12.tgz]] --in : the BAM file to be splitReleased 5/14/2014 --out : the base filename for the SAM/BAM files to write into. Does ** Requires, but does not include the extension: [[LibStatGen Download#Official Releases|libStatGen version 1. _N will be appended to the basename where N indicates the Chromosome0.12]] Optional Parameters** Update [[BamUtil:mergeBam|mergeBam]] --noeof : do not expect an EOF block on *** Add a bam file.regions option --bamIndex ** Update to [[BamUtil: squeeze|squeeze]], [[BamUtil: revert|revert]], [[BamUtil: the path/name of the bam index filediff|diff]] (if not specified*** Also accept ', uses the --in value + ".bai") --bamout : write ' instead of just ';' as the output files delimiter in BAM format (default). --samout : write the output files in SAM formatinput tags string. --params : print the parameter settings</pre>
=== Usage ===* [[Media:BamUtil.1.0.11.tgz|BamUtil.1.0.11.tgz]] - Released 2/28/2014** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.11]]*** Adds support for 'B' & 'f' tags that did not work properly before.** Update [[BamUtil: splitBam|splitBam]] & [[BamUtil: polishBam|polishBam]]*** Update to work properly if log & output file are not specified (no longer creates '.log')** Update Main dummy/example tool to indicate the correct tool** Update to [[BamUtil: bam2FastQ|bam2FastQ]], [[BamUtil: clipOverlap|clipOverlap]], [[BamUtil: filter|filter]], [[BamUtil: mergeBam|mergeBam]], [[BamUtil: splitBam|splitBam]], [[BamUtil: squeeze|squeeze]], [[BamUtil: stats|stats]]*** Cleanup usage/parameter descriptions** Update [[BamUtil: revert|revert]]*** Update compatibility with libStatGen due to 'B' & 'f' tag handling updates** Add tests for 'B' & 'f' tags
* [[Media:BamUtil.1.0.10.tar.gz|BamUtil.1.0.10.tar.gz]] - Released 1/2/2014** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.10]]** All*** Add PhoneHome/bam splitChromosome --in <inputFilename> version checking*** Make sub-program names case independent*** Fix Logger.cpp compiler warning** Adds: [[BamUtil: explainFlags|explainFlags]] -describes the SAM/BAM flags based on the flag value** Update to [[BamUtil: stats|stats]]*** Fix Stats to not try to not try to process a record after it is out <outputFileBaseName> of the loop (it would already have been processed or is invalid)** Update to [[BamUtil: splitBam|splitBam]]*** fix description of --bamIndex <bamIndexFile>noeof option** Update to [[BamUtil: writeRegion|writeRegion] ]*** add exclude/required flags** Update to [--noeof[BamUtil: dedup|dedup]] & [[BamUtil: recab|recab]] *** Ignore secondary reads for dedup and making the recalibration table.*** skip QC Failures*** add excludeFlags parameters** Update to [--bamout[BamUtil: clipOverlap|--samoutclipOverlap]] *** add exclude flags*** fix bug for readName sorted when a read is filtered due to flags*** add sorting validation** Update to [[BamUtil: bam2FastQ|bam2FastQ]]*** add --paramsmerge option to generate interleaved files.*** update to open the input file before opening the output files, so if there is an error, the outputs aren't opened** Update to [[BamUtil: mergeBam|mergeBam]]*** add option to ignore the RG PI field when checking headers*** add more informative header merge error messages
* [[Media:BamUtil.1.0.9.tgz|BamUtil.1.0.9.tgz]] - Released 7/7/2013
** Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.9]] (version 1.0.7 should also work)
** Update to [[BamUtil: mergeBam|mergeBam]]
*** Update to ignore PG lines with duplicate IDs
*** Update to accept merges of matching RG lines
*** Update to log to stderr if no log/out file is specified
=== Return Value ===*[[Media:BamUtil.1.0.7.tgz|BamUtil.1.0.7.tgz]] - Released 1/29/2013* * Requires, but does not include: [[LibStatGen Download#Official Releases|libStatGen version 1.0.7]] or above** Update to fix some compile issues on ubuntu 12.10** Update use of SamRecord::getStringTag to expect the return of a const string pointer due to libStatGen v1.0.7 updates** Update SamReferenceInfo usage due to libStatGen v1.0.7 updates** Update to [[BamUtil: all diff|diff]]*** Fix DIFF to test and properly handle running out of available records are successfully . Previously no message was printed when this happened and there was a bug for which file it freed** Update to [[BamUtil: clipOverlap|clipOverlap]]*** Update to facilitate adding other overlap handling functions** Update to [[BamUtil: mergeBam|mergeBam]] (formerly RGMergeBam)*** Rename RGMergeBam to MergeBam*** Update to handle files that already have an RG*[[Media:BamUtil.1.0.6.tgz|BamUtil.1.0.6.tgz]] - Released 11/14/2012** Update to [[BamUtil: trimBam|trimBam]]*** Update to allow trimming a different number of bases from each end of the read and written*[[Media:BamUtil.1.0.5.tgz|BamUtil.1.0.5.tgz]] - Released 10/24/2012** Update to [[BamUtil: dedup|dedup]]*** Update logic for which pair to keep if they have the same quality** Update to [[BamUtil: polishBam|polishBam]]*** Update to print the number of successful header additions* non* Update to [[BamUtil: recab|recab]]*** Update to print the number of base skipped due to the base quality** General Updates*** Update to add compile option to compile without C++0x/C++11*BamUtil.1.0.4.tgz -Released skipped*[[Media:BamUtil.1.0.3.tgz|BamUtil.1.0.3.tgz]] - Released 09/19/2012** Adds: [[BamUtil: dedup|dedup]] [[BamUtil: recab|recab]]** General Updates*** Update Logger to write to stderr if output is stdout** Update to [[BamUtil: stats|stats]]*** Add required/exclude flags*** Exclude Clips if excluding umapped*** Add --withinRegion flag*** Update phred/qual counts to be uint64_t instead of int to avoid overflow** Update to [[BamUtil: validate|validate]]*** Detect header failures** Update to [[BamUtil: diff|diff]]*** Update to specify chromosome/pos in ZP as a string rather than int so both can be shown** Update to [[BamUtil: at least one record was readReference|readReference]]*** Output error message if the reference name is not found** Update to [[BamUtil: splitChromosome|splitChromosome]]*** Update to actually split the chromosomes and not successfully read or writtenjust hard coded to output chromosomes ids 0-22** Update Makefile to have cloneLib for cloning libStatGen*[[Media:BamUtil.1.0.2.tgz|BamUtil.1.0.2.tgz]] - Released 05/16/2012** Adds: [[BamUtil: bam2FastQ|bam2FastQ]]*[[Media:BamUtil.1.0.1.tgz|BamUtil.1.0.1.tgz]] - Released 05/04/2012** Adds: [[BamUtil: splitBam|splitBam]], [[BamUtil: clipOverlap|clipOverlap]], [[BamUtil: trimBam|trimBam]], [[BamUtil: polishBam|polishBam]], [[BamUtil: rgMergeBam|rgMergeBam]], [[BamUtil: gapInfo|gapInfo]]** Adds additional functionality to [[BamUtil: stats|stats]]** Adds leftShifting to [[BamUtil: writeRegion|writeRegion]] and [[BamUtil: convert|convert]]** Adds more diff fields to [[BamUtil: diff|diff]]*[[Media:BamUtil.1.0.0.tgz|BamUtil.1.0.0.tgz]] - Released 10/10/2011**Initial release of just bamUtil. It started from the tool found in the deprecated StatGen repository.**Contains: [[BamUtil: validate|validate]], [[BamUtil: convert|convert]], [[BamUtil: dumpHeader|dumpHeader]], [[BamUtil: splitChromosome|splitChromosome]], [[BamUtil: writeRegion|writeRegion]], [[BamUtil: dumpRefInfo|dumpRefInfo]], [[BamUtil: dumpIndex|dumpIndex]], [[BamUtil: readIndexedBam|readIndexedBam]], [[BamUtil: filter|filter]], [[BamUtil: readReference|readReference]], [[BamUtil: revert|revert]], [[BamUtil: diff|diff]], [[BamUtil: squeeze|squeeze]], [[BamUtil: findCigars|findCigars]], [[BamUtil: stats|stats]]
=== Example Output =Citation ==<pre>If you use BamUtil, please cite our publication on GotCloud which includes BamUtil: Reference ID -1 has 2 recordsReference ID 0 has 5 recordsReference ID 1 has 2 recordsReference ID 2 has 1 recordsReference ID 3 has 0 recordsReference ID 4 has 0 recordsReference ID 5 has 0 recordsReference ID 6 has 0 recordsReference ID 7 has 0 recordsReference ID 8 has 0 recordsReference ID 9 has 0 recordsReference ID 10 has 0 recordsReference ID 11 has 0 recordsReference ID 12 has 0 recordsReference ID 13 has 0 recordsReference ID [http://genome.cshlp.org/content/early/2015/04/14 has 0 recordsReference ID 15 has 0 recordsReference ID 16 has 0 recordsReference ID 17 has 0 recordsReference ID 18 has 0 recordsReference ID 19 has 0 recordsReference ID 20 has 0 recordsReference ID 21 has 0 recordsReference ID 22 has 0 recordsNumber of records = 10Returning: 0 /gr.176552.114.abstract Jun, Goo, et al. "An efficient and scalable analysis framework for variant extraction and refinement from population scale DNA sequence data." Genome research (SUCCESS2015)</pre>: gr-176552.]
== writeRegion =Programs =
The <code>writeRegion</code> option on software reads the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position). === Parameters ===<pre> Required Parameters: --in : the BAM beginning of an input file to be read --out : the determine if it is SAM/BAM file to write to Optional Parameters: --noeof : do not expect an EOF block on a bam file. --bamIndex : the path/name of the bam index file (if not specified, uses the --in value + ".bai") --refName : To determine the BAM reference Name to read format (either this or refID can be specified) --refID : the BAM reference ID to read (defaults to -1: unmapped) --start : inclusive 0-based start position (defaults to -1) --end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference) --params : print the parameter settings</pre> === Usage === ./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] [--params] === Return Value ===* 0: all records are successfully read and written.* non-0: at least one record was not successfully read or written. === Example Output ===<pre> Wrote t.sam with 2 records.</pre> == dumpRefInfo ==The <code>dumpRefInfo</code> option on the bam executable prints the SAM/BAM file's reference information. === Parameters ===<pre> Required Parameters: --in : the SAM/BAM file to be read Optional Parameters: --noeof : do not expect an EOF block on a bam file. --printRecordRefs : print the reference information for the records in the file (grouped by reference). --params : print the parameter settings</pre> === Usage === ./bam dumpRefInfo --in <inputFilename> [--noeof] [--printRecordRefs] [--params] === Return Value ===* 0: the file was processed successfully.* non-0: the file was not processed successfully. == dumpIndex ==The <code>dumpIndex</code> option on the bam executable prints BAM index file in an easy to read format. === Parameters ===<pre> Required Parameters: --bamIndex : the path/name of the bam index output file to display Optional Parameters: --refID : the reference ID to read, defaults to print all --summary : only print a summary - 1 line per reference. --params : print the parameter settings</pre> === Usage === ./bam dumpIndex --bamIndex <bamIndexFile> [--refID <ref#>] [--summary] [--params] === Return Value ===* 0: software checks the BAM index output file was processed successfully's extension.* non-0: If the BAM index file was not processed successfullyextension is ". == readIndexedBam ==The <code>readIndexedBam</code> option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and " it writes it out as a SAM/BAM file. === Parameters ===<pre> Required Parameters: inputFilename - path/name of the input BAM file outputFile.sam/bam - path/name of the output file bamIndexFile - path/name of the BAM index file</pre> === Usage ===./bam readIndexedBam <inputFilename> <outputFile.sam/bam> <bamIndexFile> === Return Value ===* 0 == filter == The <code>filter</code> option on the bam executable filters the reads in a , otherwise it writes a SAM/BAM file. This option is documented at: [[Bam Executable: Filter]] == readReference ==The <code>readReference</code> option on the bam executable prints the specified region of the reference sequence in an easy to read format. === Parameters ===<pre> Required Parameters: --refFile : the reference --refName : the SAM/BAM reference Name to read --start : inclusive 0-based start position (defaults to -1) Required Length Parameter (one but not both needs to be specified): --end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference) --numBases : number of bases from start to display --params : print the parameter settings</pre> === Usage === ./bam readReference --refFile <referenceFilename> --refName <reference Name> --start <0 based start> --end <0 based end>|--numBases <number of bases> [--params] === Return Value ===* 0: the reference file was successfully read.* non-0: the reference file was not successfully read. === Example Output ===<pre>
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA</pre>{{BamUtilPrograms}}