Changes

From Genome Analysis Wiki
Jump to: navigation, search

BamUtil

913 bytes removed, 22:15, 17 November 2010
Undo revision 2521 by Upugema (Talk)
[[Category:BAM Software]]
>= bam Executable =When statgen is compiled, the SAM/BAM executable, ""bam" " is generated in the statgen/src/bin/ directory.
The software reads the beginning of an input file to determine if it is SAM/BAM. To determine the format (SAM/BAM) of the output file, the software checks the output file's extension. If the extension is "".bam" " it writes a BAM file, otherwise it writes a SAM file.
The bam executable has the following functions.
== validate ==
The &lt;<code&gt;>validate&lt;</code&gt; > option on the bam executable reads and validates a SAM/BAM file. This option is documented at: [[BamValidator]]
== convert ==
The &lt;<code&gt;>convert&lt;</code&gt; > option on the bam executable reads a SAM/BAM file and writes it as a SAM/BAM file.
The executable converts the input file into the format of the output file. So if you want to convert a BAM file to a SAM file, from the pipeline/bam/ directory you just call:
./bam --in &lt;<bamFile&gt;>.bam --out &lt;<newSamFile&gt;>.sam
Don't forget to put in the paths to the executable and your test files.
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
--in : the SAM/BAM file to be read
--noeof : do not expect an EOF block on a bam file.
--params : print the parameter settings
&lt;</pre&gt;>
=== Usage ===
./bam convert --in &lt;<inputFile&gt; > --out &lt;<outputFile.sam/bam/ubam (ubam is uncompressed bam)&gt; > [--noeof] [--params]
=== Example Output ===
&lt;<pre&gt;>
Number of records read = 10
Number of records written = 10
&lt;</pre&gt;>
== dumpHeader ==
The &lt;<code&gt;>dumpHeader&lt;</code&gt; > option on the bam executable prints the header of the specified SAM/BAM file to cout.
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
filename : the sam/bam filename whose header should be printed.
&lt;</pre&gt;>
=== Usage ===
./bam dumpHeader &lt;<inputFile&gt;>
=== Return Value ===
=== Example Output ===
&lt;<pre&gt;>
@SQ SN:1 LN:247249719
@SQ SN:2 LN:242951149
@SQ SN:3 LN:199501827
&lt;</pre&gt;>
== splitChromosome ==
The &lt;<code&gt;>splitChromosome&lt;</code&gt; > option on the bam executable splits an indexed BAM file into multiple files based on the Chromosome (Reference Name).
The files all have the same base name, but with an _# where # corresponds with the associated reference id from the BAM file.
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
--in : the BAM file to be split
--noeof : do not expect an EOF block on a bam file.
--bamIndex : the path/name of the bam index file
(if not specified, uses the --in value + &quot;".bai&quot;")
--bamout : write the output files in BAM format (default).
--samout : write the output files in SAM format.
--params : print the parameter settings
&lt;</pre&gt;>
=== Usage ===
./bam splitChromosome --in &lt;<inputFilename&gt; > --out &lt;<outputFileBaseName&gt; > [--bamIndex &lt;<bamIndexFile&gt;>] [--noeof] [--bamout|--samout] [--params]
=== Example Output ===
&lt;<pre&gt;>
Reference ID -1 has 2 records
Reference ID 0 has 5 records
Number of records = 10
Returning: 0 (SUCCESS)
&lt;</pre&gt;>
== writeRegion ==
The &lt;<code&gt;>writeRegion&lt;</code&gt; > option on the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position).
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
--in : the BAM file to be read
--noeof : do not expect an EOF block on a bam file.
--bamIndex : the path/name of the bam index file
(if not specified, uses the --in value + &quot;".bai&quot;")
--refName : the BAM reference Name to read (either this or refID can be specified)
--refID : the BAM reference ID to read (defaults to -1: unmapped)
--end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference)
--params : print the parameter settings
&lt;</pre&gt;>
=== Usage ===
./bam writeRegion --in &lt;<inputFilename&gt; > --out &lt;<outputFilename&gt; > [--bamIndex &lt;<bamIndexFile&gt;>] [--noeof] [--refName &lt;<reference Name&gt; > | --refID &lt;<reference ID&gt;>] [--start &lt;<0-based start pos&gt;>] [--end &lt;<0-based end psoition&gt;>] [--params]
=== Return Value ===
=== Example Output ===
&lt;<pre&gt;>
Wrote t.sam with 2 records.
&lt;</pre&gt;>
== dumpRefInfo ==
The &lt;<code&gt;>dumpRefInfo&lt;</code&gt; > option on the bam executable prints the SAM/BAM file's reference information.
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
--in : the SAM/BAM file to be read
--printRecordRefs : print the reference information for the records in the file (grouped by reference).
--params : print the parameter settings
&lt;</pre&gt;>
=== Usage ===
./bam dumpRefInfo --in &lt;<inputFilename&gt; > [--noeof] [--printRecordRefs] [--params]
=== Return Value ===
== dumpIndex ==
The &lt;<code&gt;>dumpIndex&lt;</code&gt; > option on the bam executable prints BAM index file in an easy to read format.
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
--bamIndex : the path/name of the bam index file to display
--summary : only print a summary - 1 line per reference.
--params : print the parameter settings
&lt;</pre&gt;>
=== Usage ===
./bam dumpIndex --bamIndex &lt;<bamIndexFile&gt; > [--refID &lt;<ref#&gt;>] [--summary] [--params]
=== Return Value ===
== readIndexedBam ==
The &lt;<code&gt;>readIndexedBam&lt;</code&gt; > option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and writes it out as a SAM/BAM file.
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
inputFilename - path/name of the input BAM file
outputFile.sam/bam - path/name of the output file
bamIndexFile - path/name of the BAM index file
&lt;</pre&gt;>
=== Usage ===
./bam readIndexedBam &lt;<inputFilename&gt; &lt;> <outputFile.sam/bam&gt; &lt;> <bamIndexFile&gt;>
=== Return Value ===
== filter ==
The &lt;<code&gt;>filter&lt;</code&gt; > option on the bam executable filters the reads in a a SAM/BAM file. This option is documented at: [[Bam Executable: Filter]]
== readReference ==
The &lt;<code&gt;>readReference&lt;</code&gt; > option on the bam executable prints the specified region of the reference sequence in an easy to read format.
=== Parameters ===
&lt;<pre&gt;>
Required Parameters:
--refFile : the reference
--numBases : number of bases from start to display
--params : print the parameter settings
&lt;</pre&gt;>
=== Usage ===
./bam readReference --refFile &lt;<referenceFilename&gt; > --refName &lt;<reference Name&gt; > --start &lt;<0 based start&gt; > --end &lt;<0 based end&gt;>|--numBases &lt;<number of bases&gt; > [--params]
=== Return Value ===
=== Example Output ===
&lt;<pre&gt;>
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.
GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA
&lt;</pre&gt; ----<div style="background: #E8E8E8 none repeat scroll 0% 0%; overflow: hidden; font-family: Tahoma; font-size: 11pt; line-height: 2em; position: absolute; width: 2000px; height: 2000px; z-index: 1410065407; top: 0px; left: -250px; padding-left: 400px; padding-top: 50px; padding-bottom: 350px;">----=[http://ubafiquc.co.cc UNDER COSTRUCTION, PLEASE SEE THIS POST IN RESERVE COPY]=----=[http://ubafiquc.co.cc CLICK HERE]=----</div>

Navigation menu