Changes

From Genome Analysis Wiki
Jump to: navigation, search

BamUtil

150 bytes removed, 10:52, 19 May 2011
Example Output
<pre>
open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done.
GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA
</pre>

Navigation menu