Line 3: |
Line 3: |
| The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences. | | The Variant Call Format (VCF) is a flexible file format specification that allows us to represent many different variant types ranging from SNPs, indels to copy number variations. However, variant representation in VCF is non-unique for variants that have explicitly expressed reference and alternate sequences. |
| | | |
− | On this wiki page, we describe a a variant classification system for VCF entries that is invariant to normalization. | + | On this wiki page, we describe a a variant classification system for VCF entries that is invariant to [http://genome.sph.umich.edu/wiki/Variant_Normalization normalization] except for the case of MNPs. |
| | | |
| = Definitions = | | = Definitions = |
Line 12: |
Line 12: |
| : The reference and alternate sequences are of length 1 and the base nucleotide is different from one another. | | : The reference and alternate sequences are of length 1 and the base nucleotide is different from one another. |
| ;2. MNP | | ;2. MNP |
− | : a.The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another. | + | : The reference and alternate sequences are of the same length and have to be greater than 1 and all nucleotides in the sequences differ from one another. |
| : OR | | : OR |
− | : b. all reference and alternate sequences have the same length. | + | : All reference and alternate sequences have the same length (this is applicable to all alleles). |
| ;3. INDEL | | ;3. INDEL |
− | : a. The reference and alternate sequence are not the same length. | + | : The reference and alternate sequences are not of the same length. |
| ;4. CLUMPED | | ;4. CLUMPED |
− | : a. A clumping of nearby SNPs, MNPs or Indels. | + | : A clumping of nearby SNPs, MNPs or Indels. |
| ;5. SV | | ;5. SV |
− | : The alternate sequence is represented by a angled bracket tag. | + | : The alternate sequence is represented by an angled bracket tag. |
| | | |
| = Classification Procedure = | | = Classification Procedure = |
| | | |
− | ;1. Trim each allele
| + | #Trim each allele with respect to the reference sequence individually |
− | ;2. Inspect length to define INDEL and count insertions or deletions
| + | #Inspect length, defined as length of alternate allele minus length of reference allele. |
− | ;3. Inspect overlapping fragments to count transitions and transversions
| + | ##if length = 0 |
− | : a. if shorter allele is of length 1, check overlap on both ends,
| + | ###if length(ref) = 1 and nucleotides differ, classify as SNP (count ts and tv too) |
− | : if one of the ends match, ignore ts/tv counts.
| + | ###if length(ref) > 1 |
− | : else, align strictly on 5' end and count transitions and transversions.
| + | ####if all nucleotides differ, classify as MNP (count ts and tv too) |
− | : b. If all overlapping nucleotides do not match, assign SNP if shorter allele is of length 1 and MNP if not.
| + | ####if not all nucleotides differ, classify as CLUMPED (count ts and tv too) |
− | : else assign CLUMPED
| + | ##if length <math>\ne</math> 0, classify as INDEL |
− | ;4. Variant classification is the union of the classifications of each allele.
| + | ###if shorter allele is of length 1 |
− | ;5. If all alleles are the same length, assign MNP to the entire variant.
| + | ####if shorter allele does not match either of the end nucleotides of the longer allele, add SNP classification |
| + | ###if shorter allele length > 1 |
| + | ####compare the shorter allele sequence with the subsequence in the 5' end of the longer allele (count ts and tv too) |
| + | #####if all nucleotides differ, add MNP classification |
| + | #####if not all nucleotides differ, add CLUMPED classification |
| + | #Variant classification is the union of the classifications of each allele present in the variant. |
| + | #If all alleles are the same length, add MNP classification. |
| | | |
| = Examples = | | = Examples = |
| | | |
− | We present the following examples to explain the concepts explained earlier. | + | We present the following examples to explain the classification described. |
| | | |
| == Legend for examples == | | == Legend for examples == |
Line 54: |
Line 60: |
| MNP<br> | | MNP<br> |
| REF AT | | REF AT |
− | ALT GC #MPN, 2 ts | + | ALT GC #MNP, 2 ts |
| | | |
| INDEL<br> | | INDEL<br> |
Line 63: |
Line 69: |
| REF AT | | REF AT |
| ALT T #INDEL, 1 del | | ALT T #INDEL, 1 del |
| + | #Note that although the padding base differs - A vs T, this is actually a simple indel because it is simply a deletion of a A base. |
| + | #If you right align this instead of left aligning, then the padding will be T on both the reference and alternative alleles. |
| + | #Simple Indel classification should be invariant whether it is left or right aligned. |
| | | |
| SV<br> | | SV<br> |
Line 73: |
Line 82: |
| REF AT | | REF AT |
| ALT G #SNP, INDEL, 1 ts | | ALT G #SNP, INDEL, 1 ts |
| + | #Note that it is ambiguous as to which pairing should be a SNP, as such, the transition or transversion contribution is actually |
| + | #not defined. In this case, assuming it is a A/G SNP, we get a transition, but we may also consider this as a T/G SNP which |
| + | #is a transversion. In such ambiguous cases, we simply consider the aligned bases after left alignment to get the transition |
| + | #and transversion contribution. But please be very clear that this is an ambiguous case. It is better to consider this simply |
| + | #as a complex variant. |
| | | |
| MNP|INDEL<br> | | MNP|INDEL<br> |
Line 80: |
Line 94: |
| MNP|CLUMPED<br> | | MNP|CLUMPED<br> |
| REF ATTTT | | REF ATTTT |
− | ALT GTTTC #MNP, CLUMEPD, 2 ts | + | ALT GTTTC #MNP, CLUMPED, 2 ts |
− | #since all the alleles are of the sample length, classified as MNP too.
| + | #since all the alleles are of the same length, classified as MNP too. |
| | | |
| INDEL|CLUMPED<br> | | INDEL|CLUMPED<br> |
Line 110: |
Line 124: |
| ALT GT #SNP, 1 ts | | ALT GT #SNP, 1 ts |
| ALT AC #SNP, 1 ts | | ALT AC #SNP, 1 ts |
− | #since all the alleles are of the sample length, classified as MNP too.
| + | #since all the alleles are of the sample length, classified as MNP too. |
| | | |
| SNP|MNP|CLUMPED<br> | | SNP|MNP|CLUMPED<br> |
| REF ATTTG | | REF ATTTG |
| ALT GTTTC #CLUMPED, 1 ts, 1 tv | | ALT GTTTC #CLUMPED, 1 ts, 1 tv |
− | ALT ATTTC #SNP, 1 tv | + | ALT ATTTC #SNP, 1 tv, note that we get the SNP after truncating the bases ATTT to reveal a G/C transversion SNP |
− | #since all the alleles are of the sample length, classified as MNP too.
| + | #since all the alleles are of the sample length, classified as MNP too. |
| | | |
| SNP|MNP|INDEL<br> | | SNP|MNP|INDEL<br> |
Line 129: |
Line 143: |
| ALT AG #MNP, INDEL, 1 ts, 1 tv | | ALT AG #MNP, INDEL, 1 ts, 1 tv |
| ALT GTGTG #SNP, INDEL, CLUMPED, 1 tv, 1 ins | | ALT GTGTG #SNP, INDEL, CLUMPED, 1 tv, 1 ins |
− |
| |
− | == Weird Examples ==
| |
| | | |
| == Structured Variants Examples == | | == Structured Variants Examples == |
Line 142: |
Line 154: |
| ALT <CN4> #SV | | ALT <CN4> #SV |
| ALT <CN12> #SV | | ALT <CN12> #SV |
| + | |
| + | =Interesting Variant Types = |
| + | |
| + | Adjacent Tandem Repeats from lobSTR's tandem repeat finder panel. <br> |
| + | |
| + | |
| + | 20 9538655 <span style="color:#FF0000">ATTTATTTATTTATTTATTTATTTATTTATTTATTTATT</span><span style="color:#0000FF">CATTCATTCATTCATTCATTCATTC </span> <STR> |
| + | |
| + | This can be induced as |
| + | |
| + | one record considering only the ATTT repeats |
| + | 20 9538655 <span style="color:#FF0000">ATTTATTTATTT </span> <span style="color:#FF0000">ATTT </span> |
| + | |
| + | one record with CATT repeats |
| + | 20 9538695 <span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span> |
| + | |
| + | one record with a mix of both repeat types |
| + | 20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span> |
| + | |
| + | = Representation of close by variants = |
| + | |
| + | 1:124001690 |
| + | TTTCTTT--CAAAAAAAGATAAAAAGGTATTTCATGG |
| + | TTTCTTTAAAAAAAAAAGATAAAAAGGAATTTCATGG |
| + | |
| + | a single complex variant |
| + | CHROM POS REF ALT |
| + | 1 124001690 C AAA |
| + | |
| + | an Indel and SNP adjacent to one another |
| + | CHROM POS REF ALT |
| + | 1 124001689 T TAA |
| + | 1 124001690 C A |
| + | |
| + | Representing it as a single complex variant enforces that both "indel" and "SNP" are always together. |
| + | Representing it as 2 separate variants allows both alleles to segregate independently. |
| | | |
| = Output = | | = Output = |
Line 159: |
Line 207: |
| 3 alleles : 273 (0.89) [537/601] | | 3 alleles : 273 (0.89) [537/601] |
| 4 alleles : 3 (1.00) [9/9] <br> | | 4 alleles : 3 (1.00) [9/9] <br> |
− | no. of Indel : 6600770 | + | no. of Indel : 6600770 #also referred to as simple Indels |
| 2 alleles : 6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts | | 2 alleles : 6285861 (0.88) [2937096/3348765] #ins/del ratio and the respective counts |
| 3 alleles : 280892 (8.72) [503977/57807] | | 3 alleles : 280892 (8.72) [503977/57807] |
Line 213: |
Line 261: |
| 4 alleles : 34 (1.16) [109/94] | | 4 alleles : 34 (1.16) [109/94] |
| >=5 alleles : 4 (0.76) [13/17] <br> | | >=5 alleles : 4 (0.76) [13/17] <br> |
− | no. of Complex Substitutions : 159298 #equivalent to categories not including simple SNPs, Block Substitutions and Simple Indels | + | no. of Complex Substitutions : 159298 #equivalent to categories not including SNPs, Block Substitutions and Simple Indels |
| 2 alleles : 81508 (0.61) [60312/98113] (0.66) [32479/49029] | | 2 alleles : 81508 (0.61) [60312/98113] (0.66) [32479/49029] |
| 3 alleles : 71003 (0.69) [35811/51840] (0.34) [34268/100942] | | 3 alleles : 71003 (0.69) [35811/51840] (0.34) [34268/100942] |