From Genome Analysis Wiki
Jump to navigationJump to search
643 bytes removed
, 13:00, 13 October 2010
Line 116: |
Line 116: |
| === Example Output === | | === Example Output === |
| <pre> | | <pre> |
− | The following parameters are available. Ones with "[]" are in effect:
| |
− |
| |
− | Input Parameters
| |
− | --in [test/testFiles/sortedBam.bam], --out [chromosome], --bamIndex [],
| |
− | --noeof
| |
− | Output Type : --bamout [ON], --samout
| |
− |
| |
| Reference ID -1 has 2 records | | Reference ID -1 has 2 records |
| Reference ID 0 has 5 records | | Reference ID 0 has 5 records |
Line 182: |
Line 175: |
| === Example Output === | | === Example Output === |
| <pre> | | <pre> |
− | The following parameters are available. Ones with "[]" are in effect:
| |
− |
| |
− | Input Parameters
| |
− | --in [test/testFiles/sortedBam.bam], --out [t.sam], --bamIndex [],
| |
− | --refName [], --refID, --start [1], --end [100], --noeof
| |
| | | |
| Wrote t.sam with 2 records. | | Wrote t.sam with 2 records. |
Line 279: |
Line 267: |
| === Example Output === | | === Example Output === |
| <pre> | | <pre> |
− | The following parameters are available. Ones with "[]" are in effect:
| |
− | Input Parameters
| |
− | --refFile [/home/mktrost/data/human.g1k.v37.fa], --refName [1],
| |
− | --start [43000], --end [-1], --numBases [71]
| |
| | | |
| open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done. | | open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done. |
| GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA | | GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA |
| </pre> | | </pre> |