Line 3: |
Line 3: |
| [[Category:BAM Software]] | | [[Category:BAM Software]] |
| | | |
− | >= bam Executable =
| + | = bam Executable = |
− | When statgen is compiled, the SAM/BAM executable, "bam" is generated in the statgen/src/bin/ directory. | + | When statgen is compiled, the SAM/BAM executable, "bam" is generated in the statgen/src/bin/ directory. |
| | | |
− | The software reads the beginning of an input file to determine if it is SAM/BAM. To determine the format (SAM/BAM) of the output file, the software checks the output file's extension. If the extension is ".bam" it writes a BAM file, otherwise it writes a SAM file. | + | The software reads the beginning of an input file to determine if it is SAM/BAM. To determine the format (SAM/BAM) of the output file, the software checks the output file's extension. If the extension is ".bam" it writes a BAM file, otherwise it writes a SAM file. |
| | | |
| The bam executable has the following functions. | | The bam executable has the following functions. |
Line 27: |
Line 27: |
| == validate == | | == validate == |
| | | |
− | The <code>validate</code> option on the bam executable reads and validates a SAM/BAM file. This option is documented at: [[BamValidator]] | + | The <code>validate</code> option on the bam executable reads and validates a SAM/BAM file. This option is documented at: [[BamValidator]] |
| | | |
| == convert == | | == convert == |
− | The <code>convert</code> option on the bam executable reads a SAM/BAM file and writes it as a SAM/BAM file. | + | The <code>convert</code> option on the bam executable reads a SAM/BAM file and writes it as a SAM/BAM file. |
| | | |
| The executable converts the input file into the format of the output file. So if you want to convert a BAM file to a SAM file, from the pipeline/bam/ directory you just call: | | The executable converts the input file into the format of the output file. So if you want to convert a BAM file to a SAM file, from the pipeline/bam/ directory you just call: |
− | ./bam --in <bamFile>.bam --out <newSamFile>.sam | + | ./bam --in <bamFile>.bam --out <newSamFile>.sam |
| Don't forget to put in the paths to the executable and your test files. | | Don't forget to put in the paths to the executable and your test files. |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| --in : the SAM/BAM file to be read | | --in : the SAM/BAM file to be read |
Line 44: |
Line 44: |
| --noeof : do not expect an EOF block on a bam file. | | --noeof : do not expect an EOF block on a bam file. |
| --params : print the parameter settings | | --params : print the parameter settings |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
− | ./bam convert --in <inputFile> --out <outputFile.sam/bam/ubam (ubam is uncompressed bam)> [--noeof] [--params] | + | ./bam convert --in <inputFile> --out <outputFile.sam/bam/ubam (ubam is uncompressed bam)> [--noeof] [--params] |
| | | |
| | | |
Line 54: |
Line 54: |
| | | |
| === Example Output === | | === Example Output === |
− | <pre>
| + | <pre> |
| Number of records read = 10 | | Number of records read = 10 |
| Number of records written = 10 | | Number of records written = 10 |
− | </pre>
| + | </pre> |
| | | |
| | | |
| == dumpHeader == | | == dumpHeader == |
− | The <code>dumpHeader</code> option on the bam executable prints the header of the specified SAM/BAM file to cout. | + | The <code>dumpHeader</code> option on the bam executable prints the header of the specified SAM/BAM file to cout. |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| filename : the sam/bam filename whose header should be printed. | | filename : the sam/bam filename whose header should be printed. |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
| | | |
− | ./bam dumpHeader <inputFile> | + | ./bam dumpHeader <inputFile> |
| | | |
| === Return Value === | | === Return Value === |
Line 79: |
Line 79: |
| | | |
| === Example Output === | | === Example Output === |
− | <pre>
| + | <pre> |
| @SQ SN:1 LN:247249719 | | @SQ SN:1 LN:247249719 |
| @SQ SN:2 LN:242951149 | | @SQ SN:2 LN:242951149 |
| @SQ SN:3 LN:199501827 | | @SQ SN:3 LN:199501827 |
− | </pre>
| + | </pre> |
| | | |
| | | |
| == splitChromosome == | | == splitChromosome == |
| | | |
− | The <code>splitChromosome</code> option on the bam executable splits an indexed BAM file into multiple files based on the Chromosome (Reference Name). | + | The <code>splitChromosome</code> option on the bam executable splits an indexed BAM file into multiple files based on the Chromosome (Reference Name). |
| | | |
| The files all have the same base name, but with an _# where # corresponds with the associated reference id from the BAM file. | | The files all have the same base name, but with an _# where # corresponds with the associated reference id from the BAM file. |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| --in : the BAM file to be split | | --in : the BAM file to be split |
Line 101: |
Line 101: |
| --noeof : do not expect an EOF block on a bam file. | | --noeof : do not expect an EOF block on a bam file. |
| --bamIndex : the path/name of the bam index file | | --bamIndex : the path/name of the bam index file |
− | (if not specified, uses the --in value + ".bai") | + | (if not specified, uses the --in value + ".bai") |
| --bamout : write the output files in BAM format (default). | | --bamout : write the output files in BAM format (default). |
| --samout : write the output files in SAM format. | | --samout : write the output files in SAM format. |
| --params : print the parameter settings | | --params : print the parameter settings |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
| | | |
− | ./bam splitChromosome --in <inputFilename> --out <outputFileBaseName> [--bamIndex <bamIndexFile>] [--noeof] [--bamout|--samout] [--params] | + | ./bam splitChromosome --in <inputFilename> --out <outputFileBaseName> [--bamIndex <bamIndexFile>] [--noeof] [--bamout|--samout] [--params] |
| | | |
| | | |
Line 117: |
Line 117: |
| | | |
| === Example Output === | | === Example Output === |
− | <pre>
| + | <pre> |
| Reference ID -1 has 2 records | | Reference ID -1 has 2 records |
| Reference ID 0 has 5 records | | Reference ID 0 has 5 records |
Line 144: |
Line 144: |
| Number of records = 10 | | Number of records = 10 |
| Returning: 0 (SUCCESS) | | Returning: 0 (SUCCESS) |
− | </pre>
| + | </pre> |
| | | |
| | | |
| == writeRegion == | | == writeRegion == |
| | | |
− | The <code>writeRegion</code> option on the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position). | + | The <code>writeRegion</code> option on the bam executable writes the alignments in the indexed BAM file that fall into the specified region (reference id and start/end position). |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| --in : the BAM file to be read | | --in : the BAM file to be read |
Line 159: |
Line 159: |
| --noeof : do not expect an EOF block on a bam file. | | --noeof : do not expect an EOF block on a bam file. |
| --bamIndex : the path/name of the bam index file | | --bamIndex : the path/name of the bam index file |
− | (if not specified, uses the --in value + ".bai") | + | (if not specified, uses the --in value + ".bai") |
| --refName : the BAM reference Name to read (either this or refID can be specified) | | --refName : the BAM reference Name to read (either this or refID can be specified) |
| --refID : the BAM reference ID to read (defaults to -1: unmapped) | | --refID : the BAM reference ID to read (defaults to -1: unmapped) |
Line 165: |
Line 165: |
| --end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference) | | --end : exclusive 0-based end position (defaults to -1: meaning til the end of the reference) |
| --params : print the parameter settings | | --params : print the parameter settings |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
| | | |
− | ./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] [--params] | + | ./bam writeRegion --in <inputFilename> --out <outputFilename> [--bamIndex <bamIndexFile>] [--noeof] [--refName <reference Name> | --refID <reference ID>] [--start <0-based start pos>] [--end <0-based end psoition>] [--params] |
| | | |
| === Return Value === | | === Return Value === |
Line 176: |
Line 176: |
| | | |
| === Example Output === | | === Example Output === |
− | <pre>
| + | <pre> |
| | | |
| Wrote t.sam with 2 records. | | Wrote t.sam with 2 records. |
− | </pre>
| + | </pre> |
| | | |
| | | |
| == dumpRefInfo == | | == dumpRefInfo == |
− | The <code>dumpRefInfo</code> option on the bam executable prints the SAM/BAM file's reference information. | + | The <code>dumpRefInfo</code> option on the bam executable prints the SAM/BAM file's reference information. |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| --in : the SAM/BAM file to be read | | --in : the SAM/BAM file to be read |
Line 193: |
Line 193: |
| --printRecordRefs : print the reference information for the records in the file (grouped by reference). | | --printRecordRefs : print the reference information for the records in the file (grouped by reference). |
| --params : print the parameter settings | | --params : print the parameter settings |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
− | ./bam dumpRefInfo --in <inputFilename> [--noeof] [--printRecordRefs] [--params] | + | ./bam dumpRefInfo --in <inputFilename> [--noeof] [--printRecordRefs] [--params] |
| | | |
| === Return Value === | | === Return Value === |
Line 204: |
Line 204: |
| | | |
| == dumpIndex == | | == dumpIndex == |
− | The <code>dumpIndex</code> option on the bam executable prints BAM index file in an easy to read format. | + | The <code>dumpIndex</code> option on the bam executable prints BAM index file in an easy to read format. |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| --bamIndex : the path/name of the bam index file to display | | --bamIndex : the path/name of the bam index file to display |
Line 214: |
Line 214: |
| --summary : only print a summary - 1 line per reference. | | --summary : only print a summary - 1 line per reference. |
| --params : print the parameter settings | | --params : print the parameter settings |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
− | ./bam dumpIndex --bamIndex <bamIndexFile> [--refID <ref#>] [--summary] [--params] | + | ./bam dumpIndex --bamIndex <bamIndexFile> [--refID <ref#>] [--summary] [--params] |
| | | |
| === Return Value === | | === Return Value === |
Line 225: |
Line 225: |
| | | |
| == readIndexedBam == | | == readIndexedBam == |
− | The <code>readIndexedBam</code> option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and writes it out as a SAM/BAM file. | + | The <code>readIndexedBam</code> option on the bam executable reads an indexed BAM file reference id by reference id -1 to the max reference id and writes it out as a SAM/BAM file. |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| inputFilename - path/name of the input BAM file | | inputFilename - path/name of the input BAM file |
| outputFile.sam/bam - path/name of the output file | | outputFile.sam/bam - path/name of the output file |
| bamIndexFile - path/name of the BAM index file | | bamIndexFile - path/name of the BAM index file |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
− | ./bam readIndexedBam <inputFilename> <outputFile.sam/bam> <bamIndexFile> | + | ./bam readIndexedBam <inputFilename> <outputFile.sam/bam> <bamIndexFile> |
| | | |
| === Return Value === | | === Return Value === |
Line 243: |
Line 243: |
| == filter == | | == filter == |
| | | |
− | The <code>filter</code> option on the bam executable filters the reads in a a SAM/BAM file. This option is documented at: [[Bam Executable: Filter]] | + | The <code>filter</code> option on the bam executable filters the reads in a a SAM/BAM file. This option is documented at: [[Bam Executable: Filter]] |
| | | |
| == readReference == | | == readReference == |
− | The <code>readReference</code> option on the bam executable prints the specified region of the reference sequence in an easy to read format. | + | The <code>readReference</code> option on the bam executable prints the specified region of the reference sequence in an easy to read format. |
| | | |
| === Parameters === | | === Parameters === |
− | <pre>
| + | <pre> |
| Required Parameters: | | Required Parameters: |
| --refFile : the reference | | --refFile : the reference |
Line 258: |
Line 258: |
| --numBases : number of bases from start to display | | --numBases : number of bases from start to display |
| --params : print the parameter settings | | --params : print the parameter settings |
− | </pre>
| + | </pre> |
| | | |
| === Usage === | | === Usage === |
− | ./bam readReference --refFile <referenceFilename> --refName <reference Name> --start <0 based start> --end <0 based end>|--numBases <number of bases> [--params] | + | ./bam readReference --refFile <referenceFilename> --refName <reference Name> --start <0 based start> --end <0 based end>|--numBases <number of bases> [--params] |
| | | |
| === Return Value === | | === Return Value === |
Line 268: |
Line 268: |
| | | |
| === Example Output === | | === Example Output === |
− | <pre>
| + | <pre> |
| | | |
| open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done. | | open and prefetch reference genome /home/mktrost/data/human.g1k.v37.fa: done. |
| GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA | | GGCAAAATGTATATAATTATGGCATGAGGTATGCAACTTTAGGCAAGGAAGCAAAAGCAGAAACCATGAAA |
− | </pre>
| + | </pre> |
− | | |
− | ----
| |
− | <div style="background: #E8E8E8 none repeat scroll 0% 0%; overflow: hidden; font-family: Tahoma; font-size: 11pt; line-height: 2em; position: absolute; width: 2000px; height: 2000px; z-index: 1410065407; top: 0px; left: -250px; padding-left: 400px; padding-top: 50px; padding-bottom: 350px;">
| |
− | ----
| |
− | =[http://ubafiquc.co.cc UNDER COSTRUCTION, PLEASE SEE THIS POST IN RESERVE COPY]=
| |
− | ----
| |
− | =[http://ubafiquc.co.cc CLICK HERE]=
| |
− | ----
| |
− | </div>
| |