From Genome Analysis Wiki
Jump to navigationJump to search
279 bytes added
, 19:00, 25 February 2016
Line 57: |
Line 57: |
| | | |
| == Fractional counts == | | == Fractional counts == |
| + | |
| + | While it is natural to think of a stretch of repeat as a integer, it is useful to consider fractional counts of a repeat especially in large repeat tracts. |
| + | This is done in Tandem Repeat Finder. |
| + | |
| + | GGGTTAAGGGTTAAGGGTTAAGGGTTAAGGGTTAAGGG |
| + | |
| + | This is 5.5 copies of the repeat GGGTTAA |
| | | |
| == Scoring == | | == Scoring == |